Transcript: Human NM_031283.3

Homo sapiens transcription factor 7 like 1 (TCF7L1), mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
TCF7L1 (83439)
Length:
2985
CDS:
294..2060

Additional Resources:

NCBI RefSeq record:
NM_031283.3
NBCI Gene record:
TCF7L1 (83439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232678 TCCAGCACACTTGTCTAATAA pLKO_005 806 CDS 100% 15.000 21.000 N TCF7L1 n/a
2 TRCN0000232679 ATCCGAGCTGTCACCGTATTA pLKO_005 974 CDS 100% 13.200 18.480 N TCF7L1 n/a
3 TRCN0000232680 CATGACTCATTGAGTAGTAAT pLKO_005 2088 3UTR 100% 13.200 18.480 N TCF7L1 n/a
4 TRCN0000021708 GATCGATCCAAAGACAGGAAT pLKO.1 935 CDS 100% 4.950 6.930 N TCF7L1 n/a
5 TRCN0000021705 CCAGCACACTTGTCTAATAAA pLKO.1 807 CDS 100% 15.000 10.500 N TCF7L1 n/a
6 TRCN0000257347 CTCAGGACAGCGCGTTCTTTA pLKO_005 616 CDS 100% 13.200 9.240 N TCF7L1 n/a
7 TRCN0000095457 GAAGGAAAGTGCAGCCATTAA pLKO.1 1403 CDS 100% 13.200 9.240 N Tcf7l1 n/a
8 TRCN0000232677 GCACCTACCTGCAGATGAAAT pLKO_005 730 CDS 100% 13.200 9.240 N TCF7L1 n/a
9 TRCN0000021707 TGAAGGAAAGTGCAGCCATTA pLKO.1 1402 CDS 100% 10.800 7.560 N TCF7L1 n/a
10 TRCN0000021704 CGGGACAACTATGGTAAGAAA pLKO.1 1539 CDS 100% 5.625 3.938 N TCF7L1 n/a
11 TRCN0000021706 CCTTGGAAGAAAGTGGCACAA pLKO.1 1430 CDS 100% 4.050 2.835 N TCF7L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12735 pDONR223 100% 99.7% 99.6% None 22_24delGGC;1597G>A n/a
2 ccsbBroad304_12735 pLX_304 0% 99.7% 99.6% V5 22_24delGGC;1597G>A n/a
3 TRCN0000476823 GGTCTGTTTCACTGTGTGTTTTTA pLX_317 12.3% 99.7% 99.6% V5 22_24delGGC;1597G>A n/a
Download CSV