Transcript: Mouse NM_031396.2

Mus musculus cyclin M1 (Cnnm1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cnnm1 (83674)
Length:
5056
CDS:
10..2865

Additional Resources:

NCBI RefSeq record:
NM_031396.2
NBCI Gene record:
Cnnm1 (83674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077839 GCGGCATGATTTCTCTCTGTT pLKO.1 1770 CDS 100% 4.950 6.930 N Cnnm1 n/a
2 TRCN0000451477 CATTCTGAGGCTCCCAATAAT pLKO_005 3130 3UTR 100% 15.000 12.000 N Cnnm1 n/a
3 TRCN0000077842 CTCTACACTGACAATCGGAAA pLKO.1 1720 CDS 100% 4.050 3.240 N Cnnm1 n/a
4 TRCN0000449840 GGATCCTGAATGCTGTAATAT pLKO_005 2688 CDS 100% 15.000 10.500 N Cnnm1 n/a
5 TRCN0000451364 TGGACATTCTGTTCGTCAAAG pLKO_005 1436 CDS 100% 10.800 7.560 N Cnnm1 n/a
6 TRCN0000077838 CCATAGTTCATGCTTAGCATT pLKO.1 3240 3UTR 100% 4.950 3.465 N Cnnm1 n/a
7 TRCN0000077840 CCTGTACCTTTCGGAGAAGAT pLKO.1 1887 CDS 100% 4.950 3.465 N Cnnm1 n/a
8 TRCN0000077841 GCCTTTACCTACTATGGTGTT pLKO.1 2089 CDS 100% 4.050 2.835 N Cnnm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11827 pDONR223 100% 54.7% 58% None (many diffs) n/a
2 ccsbBroad304_11827 pLX_304 0% 54.7% 58% V5 (many diffs) n/a
3 ccsbBroadEn_15035 pDONR223 92.5% 54.5% 52.7% None (many diffs) n/a
4 ccsbBroad304_15035 pLX_304 0% 54.5% 52.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000476036 CTGATCTAGGTATCATCTTGCTCA pLX_317 19.4% 50.4% 53.8% V5 (many diffs) n/a
Download CSV