Transcript: Human NM_031469.4

Homo sapiens SH3 domain binding glutamate rich protein like 2 (SH3BGRL2), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SH3BGRL2 (83699)
Length:
4603
CDS:
134..457

Additional Resources:

NCBI RefSeq record:
NM_031469.4
NBCI Gene record:
SH3BGRL2 (83699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031469.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136425 CTTCGTGGCGATAAAGAAGAA pLKO.1 169 CDS 100% 4.950 6.930 N SH3BGRL2 n/a
2 TRCN0000134454 GATATTTAATGGCGACCGATA pLKO.1 337 CDS 100% 4.050 5.670 N SH3BGRL2 n/a
3 TRCN0000135285 CCTGCCACCTCAGATATTTAA pLKO.1 325 CDS 100% 15.000 10.500 N SH3BGRL2 n/a
4 TRCN0000134176 CAGCAAGATGTGGTTAGATTT pLKO.1 191 CDS 100% 13.200 9.240 N SH3BGRL2 n/a
5 TRCN0000136862 CCAGGGACTATCCAGGAATTT pLKO.1 2185 3UTR 100% 13.200 9.240 N SH3BGRL2 n/a
6 TRCN0000137515 GAAACCACGGTTGGCATCAAA pLKO.1 424 CDS 100% 5.625 3.938 N SH3BGRL2 n/a
7 TRCN0000134453 GAAGCCAACAAGATAGAGTTT pLKO.1 215 CDS 100% 4.950 3.465 N SH3BGRL2 n/a
8 TRCN0000135915 GCAAAGGAAATGTGCTGCTAA pLKO.1 2929 3UTR 100% 4.950 3.465 N SH3BGRL2 n/a
9 TRCN0000136760 CCCACCTTATTGCCTTTCCTT pLKO.1 4427 3UTR 100% 3.000 2.100 N SH3BGRL2 n/a
10 TRCN0000136275 GAATCCAAGGAAAGCAACACA pLKO.1 383 CDS 100% 3.000 2.100 N SH3BGRL2 n/a
11 TRCN0000136226 GAGGTGGATATCACAATGTCA pLKO.1 239 CDS 100% 3.000 2.100 N SH3BGRL2 n/a
12 TRCN0000136819 CCCTGCCACCTCAGATATTTA pLKO.1 324 CDS 100% 15.000 9.000 N SH3BGRL2 n/a
13 TRCN0000136119 GCGATAAAGAAGAAGCAGCAA pLKO.1 176 CDS 100% 2.640 1.584 N SH3BGRL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031469.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04289 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04289 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478398 TTCCCGATGACGAATCTTGATAGC pLX_317 89.5% 100% 100% V5 n/a
4 ccsbBroadEn_09108 pDONR223 100% 99.6% 99% None 116T>C n/a
5 ccsbBroad304_09108 pLX_304 0% 99.6% 99% V5 116T>C n/a
6 TRCN0000467882 CCAGCGGACGCTTTCATTTAGCGC pLX_317 93% 99.6% 99% V5 116T>C n/a
7 ccsbBroadEn_16022 pDONR223 0% 99.6% 99% None 19A>G n/a
Download CSV