Transcript: Human NM_031854.3

Homo sapiens keratin associated protein 4-12 (KRTAP4-12), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
KRTAP4-12 (83755)
Length:
1092
CDS:
61..666

Additional Resources:

NCBI RefSeq record:
NM_031854.3
NBCI Gene record:
KRTAP4-12 (83755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144473 CACTTCCTTATTACGTCCTTT pLKO.1 686 3UTR 100% 4.950 6.930 N KRTAP4-12 n/a
2 TRCN0000140416 GAGAATTGATCTGGGTCCCAT pLKO.1 750 3UTR 100% 2.640 3.696 N KRTAP4-12 n/a
3 TRCN0000140337 CATGCGGACTGTTCAAGAGAA pLKO.1 734 3UTR 100% 4.950 3.960 N KRTAP4-12 n/a
4 TRCN0000144117 CTCTTTGACTTCAGGACATTT pLKO.1 897 3UTR 100% 13.200 9.240 N KRTAP4-12 n/a
5 TRCN0000145375 GCAAACCTCATCCTTAGAAAT pLKO.1 773 3UTR 100% 13.200 9.240 N KRTAP4-12 n/a
6 TRCN0000141852 GAATTGATCTGGGTCCCATAA pLKO.1 752 3UTR 100% 10.800 7.560 N KRTAP4-12 n/a
7 TRCN0000144546 CATAAGCAAACCTCATCCTTA pLKO.1 768 3UTR 100% 4.950 3.465 N KRTAP4-12 n/a
8 TRCN0000139343 CCTACAGATGAAGGCTCTCAT pLKO.1 707 3UTR 100% 4.950 3.465 N KRTAP4-12 n/a
9 TRCN0000141568 CCTCTTTGACTTCAGGACATT pLKO.1 896 3UTR 100% 4.950 3.465 N KRTAP4-12 n/a
10 TRCN0000144398 CCTCATCCTTAGAAATTCTGT pLKO.1 778 3UTR 100% 3.000 2.100 N KRTAP4-12 n/a
11 TRCN0000141664 CCACTTCCTTATTACGTCCTT pLKO.1 685 3UTR 100% 2.640 1.848 N KRTAP4-12 n/a
12 TRCN0000139007 CCCATAAGCAAACCTCATCCT pLKO.1 766 3UTR 100% 2.640 1.848 N KRTAP4-12 n/a
13 TRCN0000145446 GAATTTGAAGATTGCCTCCAT pLKO.1 934 3UTR 100% 2.640 1.848 N KRTAP4-12 n/a
14 TRCN0000138982 CTCCCTTCCTTCCAAAGGAAT pLKO.1 824 3UTR 100% 0.495 0.347 N KRTAP4-12 n/a
15 TRCN0000139786 CTGTGAACACACCACTTCCTT pLKO.1 674 3UTR 100% 3.000 1.800 N KRTAP4-12 n/a
16 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 177 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04297 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04297 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468341 CATGCCGTACGCCCACATCGATGC pLX_317 62.9% 100% 100% V5 n/a
4 ccsbBroadEn_04474 pDONR223 100% 64% 62.6% None (many diffs) n/a
5 ccsbBroad304_04474 pLX_304 0% 64% 62.6% V5 (many diffs) n/a
6 TRCN0000480629 TACACATACCCGTACACGGAGCCC pLX_317 96.2% 64% 62.6% V5 (many diffs) n/a
Download CSV