Transcript: Human NM_031864.3

Homo sapiens protocadherin alpha 12 (PCDHA12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PCDHA12 (56137)
Length:
2582
CDS:
166..2544

Additional Resources:

NCBI RefSeq record:
NM_031864.3
NBCI Gene record:
PCDHA12 (56137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055748 GCGTTTGATAAGCCCAGCTAT pLKO.1 886 CDS 100% 4.950 6.930 N PCDHA12 n/a
2 TRCN0000055750 CCATTGATAAAGGGATTCCTT pLKO.1 1130 CDS 100% 3.000 4.200 N PCDHA12 n/a
3 TRCN0000423543 AGGGTCTGTCCAGATTCAAAT pLKO_005 834 CDS 100% 13.200 9.240 N PCDHA12 n/a
4 TRCN0000417248 CACAAGAGTGATCCAACTAAA pLKO_005 939 CDS 100% 13.200 9.240 N PCDHA12 n/a
5 TRCN0000418683 TGGAAGTTCTGGACGTGAATG pLKO_005 1178 CDS 100% 10.800 7.560 N PCDHA12 n/a
6 TRCN0000055749 GCGTTAAGTCTAAATGAGAAT pLKO.1 676 CDS 100% 4.950 3.465 N PCDHA12 n/a
7 TRCN0000055752 TCTGGTGGATATTAACGTGTA pLKO.1 2241 CDS 100% 4.050 2.835 N PCDHA12 n/a
8 TRCN0000055751 GCCTGAATTAGTTCTTCGGAA pLKO.1 738 CDS 100% 2.640 1.848 N PCDHA12 n/a
9 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 388 CDS 100% 4.950 2.475 Y PCDHA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03706 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03706 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481661 CAACCGCAGAATTGACCGTCGGGC pLX_317 22.2% 100% 100% V5 n/a
4 ccsbBroadEn_08629 pDONR223 100% 99.9% 100% None 2280T>C n/a
5 ccsbBroad304_08629 pLX_304 0% 99.9% 100% V5 2280T>C n/a
6 TRCN0000469691 TCAATTCATATCCGAGTTCCAGAC pLX_317 15.8% 99.9% 100% V5 2280T>C n/a
Download CSV