Transcript: Human NM_031883.2

Homo sapiens protocadherin alpha subfamily C, 2 (PCDHAC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PCDHAC2 (56134)
Length:
2655
CDS:
1..2655

Additional Resources:

NCBI RefSeq record:
NM_031883.2
NBCI Gene record:
PCDHAC2 (56134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055528 CCTCGGACATACTCTGAAATT pLKO.1 2092 CDS 100% 13.200 18.480 N PCDHAC2 n/a
2 TRCN0000055530 GCGTACACTGAAGGTTGAGAT pLKO.1 1356 CDS 100% 4.950 6.930 N PCDHAC2 n/a
3 TRCN0000055529 CCGACTGAATGGCTTTGGAAA pLKO.1 1230 CDS 100% 4.950 3.465 N PCDHAC2 n/a
4 TRCN0000055531 GCTTCTGTGGAGTAAGGGAAA pLKO.1 2231 CDS 100% 4.050 2.835 N PCDHAC2 n/a
5 TRCN0000055532 GCTGTCAACTCCTTTGACTAT pLKO.1 1597 CDS 100% 0.495 0.347 N PCDHAC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08627 pDONR223 100% 99.8% 100% None 117T>A;361T>C;702C>T n/a
2 ccsbBroad304_08627 pLX_304 0% 99.8% 100% V5 117T>A;361T>C;702C>T n/a
3 TRCN0000476553 ATCTAGCACTGAAGTGGAGTCCTG pLX_317 12.1% 99.8% 100% V5 117T>A;361T>C;702C>T n/a
Download CSV