Transcript: Human NM_032009.3

Homo sapiens protocadherin gamma subfamily A, 2 (PCDHGA2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PCDHGA2 (56113)
Length:
4548
CDS:
213..2684

Additional Resources:

NCBI RefSeq record:
NM_032009.3
NBCI Gene record:
PCDHGA2 (56113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053814 GCAACGACAATGCTCATGTAA pLKO.1 1654 CDS 100% 5.625 7.875 N PCDHGA2 n/a
2 TRCN0000053817 CCTCAATCTCTACTCGAAGAA pLKO.1 2592 CDS 100% 4.950 6.930 N PCDHGA2 n/a
3 TRCN0000053815 GCTGGAGGATAAATTGACTAT pLKO.1 539 CDS 100% 4.950 3.960 N PCDHGA2 n/a
4 TRCN0000053816 CCTCAGAGGTATTTGAGCTTA pLKO.1 1075 CDS 100% 4.950 3.465 N PCDHGA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08621 pDONR223 100% 99.9% 100% None 552G>A n/a
2 ccsbBroad304_08621 pLX_304 0% 99.9% 100% V5 552G>A n/a
3 TRCN0000475761 GGCAGGCGACAGGCAGGCTTGTAG pLX_317 12.4% 99.9% 100% V5 552G>A n/a
Download CSV