Transcript: Human NM_032086.1

Homo sapiens protocadherin gamma subfamily A, 6 (PCDHGA6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PCDHGA6 (56109)
Length:
2457
CDS:
1..2457

Additional Resources:

NCBI RefSeq record:
NM_032086.1
NBCI Gene record:
PCDHGA6 (56109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430869 TATCCCGTGGAAGTGGAAATA pLKO_005 349 CDS 100% 13.200 18.480 N PCDHGA6 n/a
2 TRCN0000421476 GCGAAAGTCTTAATAACTATC pLKO_005 991 CDS 100% 10.800 15.120 N PCDHGA6 n/a
3 TRCN0000053551 CCGAGAAGTCTCCCATTTGAA pLKO.1 1159 CDS 100% 5.625 7.875 N PCDHGA6 n/a
4 TRCN0000053552 GCTCAGTGGTAATAGTCACTT pLKO.1 513 CDS 100% 4.950 6.930 N PCDHGA6 n/a
5 TRCN0000053548 CCCGATTCTTAAAGGAAGAAT pLKO.1 392 CDS 100% 0.563 0.788 N PCDHGA6 n/a
6 TRCN0000053550 CGCGTAAGAGTCATCTGATTT pLKO.1 2288 CDS 100% 13.200 9.240 N PCDHGA6 n/a
7 TRCN0000415026 GTTGGCAATTATTATCGATTA pLKO_005 1192 CDS 100% 10.800 7.560 N PCDHGA6 n/a
8 TRCN0000053549 GCCCAAATTCTGGTAACAGTT pLKO.1 676 CDS 100% 4.950 2.970 N PCDHGA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03703 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03703 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477190 GCGCCACGCGACGTTTCCCCGCTC pLX_317 5.7% 100% 100% V5 n/a
Download CSV