Transcript: Human NM_032177.4

Homo sapiens phosphorylated adaptor for RNA export (PHAX), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
PHAX (51808)
Length:
3609
CDS:
17..1201

Additional Resources:

NCBI RefSeq record:
NM_032177.4
NBCI Gene record:
PHAX (51808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032177.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219882 CAATCCGAGACCTACAATTAT pLKO.1 458 CDS 100% 15.000 21.000 N PHAX n/a
2 TRCN0000219883 GCCCGAGTAGTGAGGATTATT pLKO.1 755 CDS 100% 15.000 10.500 N PHAX n/a
3 TRCN0000182971 CAGATGATGATAGCTGTCTTT pLKO.1 234 CDS 100% 4.950 3.465 N PHAX n/a
4 TRCN0000183703 GCACAGGATTTAATTTCTCAA pLKO.1 1406 3UTR 100% 4.950 3.465 N PHAX n/a
5 TRCN0000179871 CTGAACTTGGTATCTTGGGAA pLKO.1 411 CDS 100% 2.640 1.848 N PHAX n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2833 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2833 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2909 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1691 3UTR 100% 4.950 2.475 Y GJD4 n/a
10 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1691 3UTR 100% 4.950 2.475 Y C9orf85 n/a
11 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2906 3UTR 100% 4.950 2.475 Y LOC339059 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2831 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2831 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2831 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032177.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14156 pDONR223 100% 99.9% 98.7% None 1167delT n/a
2 ccsbBroad304_14156 pLX_304 0% 99.9% 98.7% V5 (not translated due to frame shift) 1167delT n/a
3 TRCN0000467933 CGGATACTACGACGTCTTTCTTTA pLX_317 33.9% 99.9% 98.7% V5 (not translated due to frame shift) 1167delT n/a
Download CSV