Transcript: Human NM_032333.5

Homo sapiens peroxiredoxin like 2A (PRXL2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PRXL2A (84293)
Length:
5801
CDS:
96..785

Additional Resources:

NCBI RefSeq record:
NM_032333.5
NBCI Gene record:
PRXL2A (84293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032333.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163958 CGGAAGATGATGTTTATGGGA pLKO.1 531 CDS 100% 0.750 1.050 N PRXL2A n/a
2 TRCN0000166644 CCTGGGAAATAGGAGGCTTAA pLKO.1 1012 3UTR 100% 10.800 7.560 N PRXL2A n/a
3 TRCN0000161185 GAAGCTGCTAAGATGATCAAA pLKO.1 735 CDS 100% 5.625 3.938 N PRXL2A n/a
4 TRCN0000162517 CTTTCAAAGCAAAGGAGCTAT pLKO.1 283 CDS 100% 4.950 3.465 N PRXL2A n/a
5 TRCN0000160886 GATGATCAAACCACAGACTTT pLKO.1 746 CDS 100% 4.950 3.465 N PRXL2A n/a
6 TRCN0000164936 GCACATCAGGACTGAAGTGAA pLKO.1 440 CDS 100% 4.950 3.465 N PRXL2A n/a
7 TRCN0000158690 GAGACAAAGTAAACCTACTTT pLKO.1 706 CDS 100% 0.563 0.394 N PRXL2A n/a
8 TRCN0000164875 GAAGGAGAAGGCTTCATCCTT pLKO.1 618 CDS 100% 0.300 0.210 N PRXL2A n/a
9 TRCN0000163109 GTGAAGGATTTCCAGCCTTAT pLKO.1 456 CDS 100% 10.800 6.480 N PRXL2A n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1064 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1064 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3715 3UTR 100% 4.950 2.475 Y ORAI2 n/a
13 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 2555 3UTR 100% 4.950 2.475 Y DENND6A n/a
14 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2594 3UTR 100% 4.050 2.025 Y P3H4 n/a
15 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2594 3UTR 100% 4.050 2.025 Y ORAI2 n/a
16 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2594 3UTR 100% 4.050 2.025 Y P3H4 n/a
17 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3712 3UTR 100% 4.950 2.475 Y LOC339059 n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1062 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1062 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1062 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2723 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032333.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12803 pDONR223 100% 95.1% 95.1% None 1_33del n/a
2 ccsbBroad304_12803 pLX_304 0% 95.1% 95.1% V5 1_33del n/a
3 TRCN0000469237 AATACCCTTACAGACCATGGATAC pLX_317 60.2% 95.1% 95.1% V5 1_33del n/a
Download CSV