Transcript: Human NM_032343.3

Homo sapiens coiled-coil-helix-coiled-coil-helix domain containing 6 (CHCHD6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
CHCHD6 (84303)
Length:
1000
CDS:
74..781

Additional Resources:

NCBI RefSeq record:
NM_032343.3
NBCI Gene record:
CHCHD6 (84303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122695 GAGCGTATTGAGAGGAAGAAT pLKO.1 551 CDS 100% 5.625 7.875 N CHCHD6 n/a
2 TRCN0000140114 GCCTTCAAGATGGCAACTTGA pLKO.1 234 CDS 100% 0.495 0.396 N CHCHD6 n/a
3 TRCN0000144296 CAAAGATGGAGAGCACAATAA pLKO.1 618 CDS 100% 13.200 9.240 N CHCHD6 n/a
4 TRCN0000122871 GCATGCTGCTATCCAGGATAA pLKO.1 352 CDS 100% 10.800 7.560 N CHCHD6 n/a
5 TRCN0000122342 CCTGAAGAAGGGACCAATCAT pLKO.1 822 3UTR 100% 5.625 3.938 N CHCHD6 n/a
6 TRCN0000139054 CCTCAAAGATGGAGAGCACAA pLKO.1 615 CDS 100% 4.050 2.835 N CHCHD6 n/a
7 TRCN0000139611 CTTTGGCCTTCAAGATGGCAA pLKO.1 229 CDS 100% 2.640 1.848 N CHCHD6 n/a
8 TRCN0000145418 GCTGAGATGTATAAACTGTCT pLKO.1 572 CDS 100% 2.640 1.848 N CHCHD6 n/a
9 TRCN0000139744 CAAGAGGTATGAACAGGAGCA pLKO.1 334 CDS 100% 2.160 1.512 N CHCHD6 n/a
10 TRCN0000122613 GCAGTGACTTGGAGCCCTGAA pLKO.1 807 3UTR 100% 1.350 0.945 N CHCHD6 n/a
11 TRCN0000143684 GAGGAAGAATGCTGAGATGTA pLKO.1 562 CDS 100% 4.950 2.970 N CHCHD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04366 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04366 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467250 ACATCTTCCGGCGTCTCCTCGCAG pLX_317 65.6% 100% 100% V5 n/a
Download CSV