Transcript: Human NM_032361.3

Homo sapiens THO complex 3 (THOC3), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
THOC3 (84321)
Length:
1617
CDS:
108..1163

Additional Resources:

NCBI RefSeq record:
NM_032361.3
NBCI Gene record:
THOC3 (84321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032361.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001303 GTGATGACAAAGACGGCAAAT pLKO.1 1084 CDS 100% 10.800 5.400 Y THOC3 n/a
2 TRCN0000342345 GTGATGACAAAGACGGCAAAT pLKO_005 1084 CDS 100% 10.800 5.400 Y THOC3 n/a
3 TRCN0000001306 GCCAAGACACACCGTTCCAAA pLKO.1 615 CDS 100% 4.950 2.475 Y THOC3 n/a
4 TRCN0000342282 GCCAAGACACACCGTTCCAAA pLKO_005 615 CDS 100% 4.950 2.475 Y THOC3 n/a
5 TRCN0000001304 GTGGATGAGTTAGTGTGTGTT pLKO.1 864 CDS 100% 4.950 2.475 Y THOC3 n/a
6 TRCN0000001302 GCAGTTCAAGTTCGAGGTCAA pLKO.1 644 CDS 100% 4.050 2.025 Y THOC3 n/a
7 TRCN0000352666 GCAGTTCAAGTTCGAGGTCAA pLKO_005 644 CDS 100% 4.050 2.025 Y THOC3 n/a
8 TRCN0000001305 GCATCCAAGTAATCCTGACCT pLKO.1 428 CDS 100% 2.640 1.320 Y THOC3 n/a
9 TRCN0000342281 GCATCCAAGTAATCCTGACCT pLKO_005 428 CDS 100% 2.640 1.320 Y THOC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032361.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09182 pDONR223 100% 99.9% 100% None 357C>T n/a
2 ccsbBroad304_09182 pLX_304 0% 99.9% 100% V5 357C>T n/a
3 TRCN0000468469 ATCAATGTTTCTTACAGGCTTAGC pLX_317 20.6% 99.9% 100% V5 357C>T n/a
Download CSV