Transcript: Human NM_032408.4

Homo sapiens bromodomain adjacent to zinc finger domain 1B (BAZ1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BAZ1B (9031)
Length:
6115
CDS:
361..4812

Additional Resources:

NCBI RefSeq record:
NM_032408.4
NBCI Gene record:
BAZ1B (9031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032408.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013340 CGATACTTTATACGGCATAAT pLKO.1 1120 CDS 100% 13.200 18.480 N BAZ1B n/a
2 TRCN0000338493 CGATACTTTATACGGCATAAT pLKO_005 1120 CDS 100% 13.200 18.480 N BAZ1B n/a
3 TRCN0000382275 ATAAGCTGCACACTAACTTTC pLKO_005 1487 CDS 100% 10.800 15.120 N BAZ1B n/a
4 TRCN0000369483 TCATGCGCAGGACTCCTATTG pLKO_005 3050 CDS 100% 10.800 15.120 N BAZ1B n/a
5 TRCN0000108939 CGGAAGCCAAATTTGGGTCTA pLKO.1 3466 CDS 100% 4.050 5.670 N Baz1b n/a
6 TRCN0000417181 AGACTGGAGTCCTGCTTATAA pLKO_005 5037 3UTR 100% 15.000 12.000 N BAZ1B n/a
7 TRCN0000380794 AGATGCTCAGTATCCTATTAC pLKO_005 2238 CDS 100% 13.200 9.240 N BAZ1B n/a
8 TRCN0000379871 GATGAAGTTCCAGGATTATTC pLKO_005 3109 CDS 100% 13.200 9.240 N BAZ1B n/a
9 TRCN0000380883 CACCTAGGACCTCTAGTAAAC pLKO_005 1739 CDS 100% 10.800 7.560 N BAZ1B n/a
10 TRCN0000013341 GCAGATGACTTTGTTGGATAT pLKO.1 1668 CDS 100% 10.800 7.560 N BAZ1B n/a
11 TRCN0000338494 GCAGATGACTTTGTTGGATAT pLKO_005 1668 CDS 100% 10.800 7.560 N BAZ1B n/a
12 TRCN0000013342 CGGGAAATCCAGGAAAGAGAA pLKO.1 2926 CDS 100% 4.950 3.465 N BAZ1B n/a
13 TRCN0000013338 CCCACAACAAATCTAGCTCTA pLKO.1 5556 3UTR 100% 4.050 2.835 N BAZ1B n/a
14 TRCN0000338431 CCCACAACAAATCTAGCTCTA pLKO_005 5556 3UTR 100% 4.050 2.835 N BAZ1B n/a
15 TRCN0000013339 GCCCTCTATGAAGTACCAGAT pLKO.1 4009 CDS 100% 4.050 2.835 N BAZ1B n/a
16 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 4154 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032408.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.