Transcript: Human NM_032439.4

Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein like (PHYHIPL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PHYHIPL (84457)
Length:
3521
CDS:
212..1342

Additional Resources:

NCBI RefSeq record:
NM_032439.4
NBCI Gene record:
PHYHIPL (84457)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032439.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417350 GGATCGCATTACACACTATTT pLKO_005 442 CDS 100% 13.200 18.480 N PHYHIPL n/a
2 TRCN0000134665 GTAATATCAGTGTTGGACGTT pLKO.1 1320 CDS 100% 2.640 3.696 N PHYHIPL n/a
3 TRCN0000257850 TAATTGCAGCATGAGTTAAAT pLKO_005 1757 3UTR 100% 15.000 10.500 N Phyhipl n/a
4 TRCN0000249026 GCAGCGCCTTCCTCAACTAAA pLKO_005 1102 CDS 100% 13.200 9.240 N Phyhipl n/a
5 TRCN0000430053 TATGTACACTGCTTATCATTA pLKO_005 1030 CDS 100% 13.200 9.240 N PHYHIPL n/a
6 TRCN0000415158 TGATGAAATACCCTAAGTTAA pLKO_005 1543 3UTR 100% 13.200 9.240 N PHYHIPL n/a
7 TRCN0000134787 CCCATCCAAACTATAAGAGAA pLKO.1 2183 3UTR 100% 4.950 3.465 N PHYHIPL n/a
8 TRCN0000134499 GCCTCTGAAATAAGTCTGTTT pLKO.1 2142 3UTR 100% 4.950 3.465 N PHYHIPL n/a
9 TRCN0000136535 CCATCTGTCAAGGATAACAGT pLKO.1 833 CDS 100% 3.000 2.100 N PHYHIPL n/a
10 TRCN0000134051 CCCAAGAACTGAATATACAGT pLKO.1 586 CDS 100% 3.000 2.100 N PHYHIPL n/a
11 TRCN0000137365 GAGAACATCATGGGAATGCTA pLKO.1 807 CDS 100% 3.000 2.100 N PHYHIPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032439.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12821 pDONR223 100% 87.6% 87.5% None 1_138del;1024G>C n/a
2 ccsbBroad304_12821 pLX_304 0% 87.6% 87.5% V5 1_138del;1024G>C n/a
3 TRCN0000467815 AGGGAGCTCCCAACTCAGTTTGGA pLX_317 35% 87.6% 87.5% V5 1_138del;1024G>C n/a
Download CSV