Transcript: Human NM_032513.5

Homo sapiens solute carrier family 30 member 2 (SLC30A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SLC30A2 (7780)
Length:
3102
CDS:
223..1194

Additional Resources:

NCBI RefSeq record:
NM_032513.5
NBCI Gene record:
SLC30A2 (7780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032513.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038314 CCATGTGATCGGCGACTTTAT pLKO.1 741 CDS 100% 13.200 18.480 N SLC30A2 n/a
2 TRCN0000423289 AGCGGGTATAAAGCTAGTGTG pLKO_005 1386 3UTR 100% 4.050 5.670 N SLC30A2 n/a
3 TRCN0000038316 ACATCGCCATTGCTCAGAATA pLKO.1 1037 CDS 100% 13.200 9.240 N SLC30A2 n/a
4 TRCN0000420571 AGGACCCTCACACTCTCATTT pLKO_005 1640 3UTR 100% 13.200 9.240 N SLC30A2 n/a
5 TRCN0000038317 GATCGGAGAAGTCGTTGAGAT pLKO.1 477 CDS 100% 4.950 3.465 N SLC30A2 n/a
6 TRCN0000038315 GCCAGAATACAAGTATGTAGA pLKO.1 807 CDS 100% 4.950 3.465 N SLC30A2 n/a
7 TRCN0000038318 CGAGGACTACTCGGAGGACAT pLKO.1 1137 CDS 100% 1.350 0.945 N SLC30A2 n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3007 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032513.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01825 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01825 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467896 TGCAGCAAGATTTACTCAAGTCCC pLX_317 22.2% 100% 100% V5 n/a
Download CSV