Transcript: Human NM_032646.6

Homo sapiens tweety family member 2 (TTYH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TTYH2 (94015)
Length:
3433
CDS:
18..1622

Additional Resources:

NCBI RefSeq record:
NM_032646.6
NBCI Gene record:
TTYH2 (94015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032646.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219958 AGACACTTTGAAACGACTTTA pLKO.1 2405 3UTR 100% 13.200 18.480 N TTYH2 n/a
2 TRCN0000172434 CGAGTACATGAACCAAGCCAT pLKO.1 1454 CDS 100% 2.640 2.112 N TTYH2 n/a
3 TRCN0000219957 TACGAGAACGTGCCACTAATC pLKO.1 1497 CDS 100% 10.800 7.560 N TTYH2 n/a
4 TRCN0000173041 CGGAACTACCCAGAAGATGAA pLKO.1 437 CDS 100% 4.950 3.465 N TTYH2 n/a
5 TRCN0000173040 CCTCATCTTCCTTGTGGCTTA pLKO.1 194 CDS 100% 4.050 2.430 N TTYH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032646.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04611 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04611 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481343 AGGTTCTTCACTCGAATTCATATA pLX_317 23.1% 100% 100% V5 n/a
4 ccsbBroadEn_09364 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
5 ccsbBroad304_09364 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
6 TRCN0000481514 CTCAGCTTATGAAGAAGGTCCCCG pLX_317 23.6% 99.7% 99.8% V5 (many diffs) n/a
Download CSV