Transcript: Human NM_032681.4

Homo sapiens tripartite motif-containing 51 (TRIM51), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TRIM51 (84767)
Length:
1629
CDS:
93..1451

Additional Resources:

NCBI RefSeq record:
NM_032681.4
NBCI Gene record:
TRIM51 (84767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032681.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434365 ATATTATTGGGAGGTTCATAT pLKO_005 1112 CDS 100% 13.200 7.920 N TRIM51 n/a
2 TRCN0000425640 TGAAAGAGCCAATAGTCATAT pLKO_005 971 CDS 100% 13.200 7.920 N TRIM51 n/a
3 TRCN0000034016 GCTTTGTTGATGTTGATCAAA pLKO.1 1354 CDS 100% 0.563 0.338 N TRIM51 n/a
4 TRCN0000237914 TTAGCTCTGAGGAGCAAATAT pLKO_005 349 CDS 100% 15.000 7.500 Y TRIM51EP n/a
5 TRCN0000034017 CAGTGGATTCAGAGTTGATTT pLKO.1 938 CDS 100% 13.200 6.600 Y TRIM51 n/a
6 TRCN0000244288 CCAGATGCTGGAAGGATTATG pLKO_005 586 CDS 100% 13.200 6.600 Y TRIM51EP n/a
7 TRCN0000427243 CTACCAGCACAGTAGGATTAT pLKO_005 1306 CDS 100% 13.200 6.600 Y TRIM51 n/a
8 TRCN0000236713 GAAAGGAGGGCGAGGACATTT pLKO_005 697 CDS 100% 13.200 6.600 Y TRIM51BP n/a
9 TRCN0000244286 ATCAGAAGATGCCTGCATTTC pLKO_005 640 CDS 100% 10.800 5.400 Y TRIM51BP n/a
10 TRCN0000034015 CCCTCAAGATGATCCCGATAT pLKO.1 1034 CDS 100% 10.800 5.400 Y TRIM51 n/a
11 TRCN0000237917 CCCTCAAGATGATCCCGATAT pLKO_005 1034 CDS 100% 10.800 5.400 Y TRIM51EP n/a
12 TRCN0000236712 GGGATGCACAGAGAGACAAAG pLKO_005 372 CDS 100% 10.800 5.400 Y TRIM51BP n/a
13 TRCN0000034018 GCAAAGCCAGAATGGAACATT pLKO.1 736 CDS 100% 5.625 2.813 Y TRIM51 n/a
14 TRCN0000034014 CCTGCATTTCTCCATGAAGAA pLKO.1 651 CDS 100% 4.950 2.475 Y TRIM51 n/a
15 TRCN0000237915 TACCAGCACAGTAGGATTATT pLKO_005 1307 CDS 100% 0.000 0.000 Y TRIM51EP n/a
16 TRCN0000033922 CATCTGCATGAACTACTTCAT pLKO.1 140 CDS 100% 0.495 0.248 Y TRIM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032681.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03779 pDONR223 100% 85.9% 74.7% None (many diffs) n/a
2 ccsbBroad304_03779 pLX_304 0% 85.9% 74.7% V5 (many diffs) n/a
3 TRCN0000479767 CGAAGACGCCTACTTGGGTCTACC pLX_317 25.8% 85.9% 74.7% V5 (many diffs) n/a
4 ccsbBroadEn_15934 pDONR223 0% 85.8% 75% None (many diffs) n/a
5 ccsbBroad304_15934 pLX_304 0% 85.8% 75% V5 (many diffs) n/a
6 TRCN0000476541 TCCAAACTTGTCGCGCACACCGTT pLX_317 25.8% 85.8% 75% V5 (many diffs) n/a
7 ccsbBroadEn_12855 pDONR223 100% 64.8% 64.8% None 1_477del n/a
8 ccsbBroad304_12855 pLX_304 0% 64.8% 64.8% V5 1_477del n/a
9 TRCN0000480296 TGTATGCGTTACCGACTAGGCAAG pLX_317 52.1% 64.8% 64.8% V5 1_477del n/a
10 ccsbBroadEn_12545 pDONR223 100% 40.5% 34.7% None (many diffs) n/a
11 ccsbBroad304_12545 pLX_304 0% 40.5% 34.7% V5 (many diffs) n/a
12 TRCN0000474512 GGGAGGGCCCAAAGGTCCATTTTA pLX_317 79.8% 40.5% 34.7% V5 (many diffs) n/a
Download CSV