Transcript: Human NM_032817.6

Homo sapiens inter-alpha-trypsin inhibitor heavy chain 5 (ITIH5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ITIH5 (80760)
Length:
6083
CDS:
84..2270

Additional Resources:

NCBI RefSeq record:
NM_032817.6
NBCI Gene record:
ITIH5 (80760)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032817.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418769 TCATTAGATATGACGTCAATA pLKO_005 217 CDS 100% 13.200 18.480 N ITIH5 n/a
2 TRCN0000118263 CCGTTTCAGTATCATTGGATT pLKO.1 428 CDS 100% 4.950 6.930 N ITIH5 n/a
3 TRCN0000118266 CATCGGGTTCTACGATGAAAT pLKO.1 854 CDS 100% 1.320 1.848 N ITIH5 n/a
4 TRCN0000416923 ACGGCTCGGAGATCATCATTG pLKO_005 964 CDS 100% 10.800 8.640 N ITIH5 n/a
5 TRCN0000118264 CCATCTACTGTCATTAACCAA pLKO.1 111 CDS 100% 3.000 2.100 N ITIH5 n/a
6 TRCN0000118265 CTGCATCTTCACCATTGGCAT pLKO.1 734 CDS 100% 2.640 1.848 N ITIH5 n/a
7 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 5294 3UTR 100% 4.050 2.025 Y TLCD4 n/a
8 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5388 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032817.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09045 pDONR223 100% 99.8% 99.8% None 135C>T;798C>T;2165G>A n/a
2 ccsbBroad304_09045 pLX_304 0% 99.8% 99.8% V5 135C>T;798C>T;2165G>A n/a
3 TRCN0000470711 AGAGGCCTGATGCCAAAGAAACCT pLX_317 17.3% 99.8% 99.8% V5 135C>T;798C>T;2165G>A n/a
4 ccsbBroadEn_16005 pDONR223 0% 51% 49% None (many diffs) n/a
5 ccsbBroad304_16005 pLX_304 0% 51% 49% V5 (many diffs) n/a
Download CSV