Transcript: Human NM_032856.4

Homo sapiens WD repeat domain 73 (WDR73), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
WDR73 (84942)
Length:
3124
CDS:
10..1146

Additional Resources:

NCBI RefSeq record:
NM_032856.4
NBCI Gene record:
WDR73 (84942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330837 AGGTCTATCTTTGATCTAAAG pLKO_005 259 CDS 100% 10.800 15.120 N WDR73 n/a
2 TRCN0000135695 CGTAGTGATATTGCGAAGGTT pLKO.1 1329 3UTR 100% 3.000 4.200 N WDR73 n/a
3 TRCN0000135232 CGAAGGTTAGAAGAAACGCAT pLKO.1 1342 3UTR 100% 2.640 3.696 N WDR73 n/a
4 TRCN0000330900 CGAAGGTTAGAAGAAACGCAT pLKO_005 1342 3UTR 100% 2.640 3.696 N WDR73 n/a
5 TRCN0000330839 AGTGGCCTTCCAGGTTGTTAT pLKO_005 310 CDS 100% 13.200 9.240 N WDR73 n/a
6 TRCN0000330838 ATGGTACAGTCCAGGTCTATG pLKO_005 899 CDS 100% 10.800 7.560 N WDR73 n/a
7 TRCN0000137656 CCTGAAGAATTGCTTGGCCAT pLKO.1 867 CDS 100% 2.160 1.512 N WDR73 n/a
8 TRCN0000135759 CACATACCAGATTGCTGGTTA pLKO.1 287 CDS 100% 0.495 0.347 N WDR73 n/a
9 TRCN0000330836 GAGGACAGTGATGTCATTAAA pLKO_005 352 CDS 100% 15.000 9.000 N WDR73 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2817 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2858 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2858 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2858 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1736 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2988 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032856.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.