Transcript: Human NM_032884.5

Homo sapiens chromosome 1 open reading frame 94 (C1orf94), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
C1orf94 (84970)
Length:
2026
CDS:
430..1656

Additional Resources:

NCBI RefSeq record:
NM_032884.5
NBCI Gene record:
C1orf94 (84970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032884.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241861 ACTCTACCTTCTTGCAGTATC pLKO_005 1283 CDS 100% 10.800 15.120 N C1orf94 n/a
2 TRCN0000241859 ATGGACCGCAGTACCTCTTTC pLKO_005 1547 CDS 100% 10.800 15.120 N C1orf94 n/a
3 TRCN0000241858 TCCAGTGGGAATGGCATAAAC pLKO_005 1630 CDS 100% 13.200 9.240 N C1orf94 n/a
4 TRCN0000241860 CAAGACCAGATTCATCTATTG pLKO_005 1785 3UTR 100% 10.800 7.560 N C1orf94 n/a
5 TRCN0000241862 CCGAGAAGAACTTGCTCTATG pLKO_005 1028 CDS 100% 10.800 7.560 N C1orf94 n/a
6 TRCN0000168080 CAGTGGGAATGGCATAAACTT pLKO.1 1632 CDS 100% 5.625 3.938 N C1orf94 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032884.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04458 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04458 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467152 TTAGCCCTAAGAGTCGGCCAGGAC pLX_317 16.7% 100% 100% V5 n/a
4 ccsbBroadEn_09249 pDONR223 100% 99.7% 99.5% None 105G>A;133C>G;336C>G n/a
5 ccsbBroad304_09249 pLX_304 0% 99.7% 99.5% V5 105G>A;133C>G;336C>G n/a
6 TRCN0000472259 CCATGTGCGGCATAGCGTTTGCCG pLX_317 28.6% 99.7% 99.5% V5 105G>A;133C>G;336C>G n/a
Download CSV