Transcript: Human NM_032955.3

Homo sapiens allograft inflammatory factor 1 (AIF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
AIF1 (199)
Length:
518
CDS:
122..403

Additional Resources:

NCBI RefSeq record:
NM_032955.3
NBCI Gene record:
AIF1 (199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029729 CCTTAATGGAAATGGCGATAT pLKO.1 133 CDS 100% 10.800 7.560 N AIF1 n/a
2 TRCN0000433720 CGTTCAGCTACCCTGACTTTC pLKO_005 258 CDS 100% 10.800 7.560 N AIF1 n/a
3 TRCN0000029731 GCAAGAGATCTGCCATCCTAA pLKO.1 294 CDS 100% 4.950 3.465 N AIF1 n/a
4 TRCN0000029730 CCTGAAACGAATGCTGGAGAA pLKO.1 166 CDS 100% 4.050 2.835 N AIF1 n/a
5 TRCN0000029733 CCAGCCAAGAAAGCTATCTCT pLKO.1 371 CDS 100% 3.000 1.500 Y AIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00043 pDONR223 100% 63.2% 63.2% None 0_1ins162 n/a
2 ccsbBroad304_00043 pLX_304 0% 63.2% 63.2% V5 0_1ins162 n/a
3 TRCN0000473009 AACGTATCCTATGGGACCTCAGTG pLX_317 100% 63.2% 63.2% V5 0_1ins162 n/a
Download CSV