Transcript: Human NM_033016.3

Homo sapiens platelet derived growth factor subunit B (PDGFB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
PDGFB (5155)
Length:
2701
CDS:
38..718

Additional Resources:

NCBI RefSeq record:
NM_033016.3
NBCI Gene record:
PDGFB (5155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039574 CGGAAATTCAAGCACACGCAT pLKO.1 662 CDS 100% 2.640 3.696 N PDGFB n/a
2 TRCN0000010411 CCGAGTTGGACCTGAACATGA pLKO.1 165 CDS 100% 4.950 3.465 N PDGFB n/a
3 TRCN0000310109 CCGAGTTGGACCTGAACATGA pLKO_005 165 CDS 100% 4.950 3.465 N PDGFB n/a
4 TRCN0000039576 CCAGGTGAGAAAGATCGAGAT pLKO.1 445 CDS 100% 4.050 2.835 N PDGFB n/a
5 TRCN0000298818 CCAGGTGAGAAAGATCGAGAT pLKO_005 445 CDS 100% 4.050 2.835 N PDGFB n/a
6 TRCN0000039573 GCAGGGTTATTTAATATGGTA pLKO.1 743 3UTR 100% 3.000 2.100 N PDGFB n/a
7 TRCN0000039577 CGAGGAGCTTTATGAGATGCT pLKO.1 70 CDS 100% 2.640 1.848 N PDGFB n/a
8 TRCN0000298819 CGAGGAGCTTTATGAGATGCT pLKO_005 70 CDS 100% 2.640 1.848 N PDGFB n/a
9 TRCN0000039575 CGCTCCTTTGATGATCTCCAA pLKO.1 107 CDS 100% 2.640 1.848 N PDGFB n/a
10 TRCN0000310324 CGCTCCTTTGATGATCTCCAA pLKO_005 107 CDS 100% 2.640 1.848 N PDGFB n/a
11 TRCN0000010412 TGACAAGACGGCACTGAAGGA pLKO.1 682 CDS 100% 2.640 1.848 N PDGFB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033016.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01162 pDONR223 100% 92.8% 91.2% None (many diffs) n/a
2 ccsbBroad304_01162 pLX_304 0% 92.8% 91.2% V5 (many diffs) n/a
3 TRCN0000467598 CACACCATAGTACTACCGGCTATC pLX_317 57.4% 92.8% 91.2% V5 (many diffs) n/a
Download CSV