Transcript: Human NM_033036.3

Homo sapiens galactose-3-O-sulfotransferase 3 (GAL3ST3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GAL3ST3 (89792)
Length:
3301
CDS:
264..1559

Additional Resources:

NCBI RefSeq record:
NM_033036.3
NBCI Gene record:
GAL3ST3 (89792)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437488 TGAGTCCCTCGCTGAACTTTG pLKO_005 1668 3UTR 100% 10.800 15.120 N GAL3ST3 n/a
2 TRCN0000438583 TCGTCATGATCGCCGAGTACT pLKO_005 973 CDS 100% 4.950 6.930 N GAL3ST3 n/a
3 TRCN0000036236 CCGCAACTTCTCGGCGCACTT pLKO.1 587 CDS 100% 0.000 0.000 N GAL3ST3 n/a
4 TRCN0000036238 CAGCACCGTAAGCCTTCTCAT pLKO.1 344 CDS 100% 4.950 3.960 N GAL3ST3 n/a
5 TRCN0000445063 TCGCCATGTTCGCACACAACA pLKO_005 853 CDS 100% 4.950 3.465 N GAL3ST3 n/a
6 TRCN0000428747 CAGAACATCCTGTTTCGCTTT pLKO_005 501 CDS 100% 4.050 2.835 N GAL3ST3 n/a
7 TRCN0000036234 CCAGTACTCGAACTACCTGTT pLKO.1 1430 CDS 100% 4.050 2.835 N GAL3ST3 n/a
8 TRCN0000036237 CAAGGTGGACATTATGGGCTA pLKO.1 1343 CDS 100% 2.160 1.512 N GAL3ST3 n/a
9 TRCN0000036235 CTTCAGCTACTACAACCAGTA pLKO.1 746 CDS 100% 4.050 2.430 N GAL3ST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033036.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15205 pDONR223 98.4% 99.8% 100% None 525A>G;1065G>A n/a
2 ccsbBroad304_15205 pLX_304 0% 99.8% 100% V5 525A>G;1065G>A n/a
3 TRCN0000476578 TCTGGCCTCCTCATATACATCAGT pLX_317 29.3% 99.8% 100% V5 525A>G;1065G>A n/a
Download CSV