Transcript: Human NM_033059.4

Homo sapiens keratin associated protein 4-11 (KRTAP4-11), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KRTAP4-11 (653240)
Length:
1193
CDS:
59..646

Additional Resources:

NCBI RefSeq record:
NM_033059.4
NBCI Gene record:
KRTAP4-11 (653240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033059.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166787 CTTCCCAGTGAGGTACACATT pLKO.1 960 3UTR 100% 4.950 3.465 N KRTAP4-11 n/a
2 TRCN0000158975 GAGGTACACATTATCTCCATT pLKO.1 969 3UTR 100% 4.950 3.465 N KRTAP4-11 n/a
3 TRCN0000166681 CCACTGACTCTGTGAGAACAT pLKO.1 791 3UTR 100% 4.950 2.970 N KRTAP4-11 n/a
4 TRCN0000337307 GTAATCCACTAGCTAAGAAAT pLKO_005 883 3UTR 100% 13.200 6.600 Y KRTAP4-8 n/a
5 TRCN0000337248 TGAGAACATTCTGGTTCATTT pLKO_005 803 3UTR 100% 13.200 6.600 Y KRTAP4-8 n/a
6 TRCN0000151612 GTGAGAACATTCTGGTTCATT pLKO.1 802 3UTR 100% 5.625 2.813 Y KRTAP4-7 n/a
7 TRCN0000159651 GTGAGAACATTCTGGTTCATT pLKO.1 802 3UTR 100% 5.625 2.813 Y KRTAP4-11 n/a
8 TRCN0000159923 CAATCCTCTAAATTCCTCATT pLKO.1 909 3UTR 100% 4.950 2.475 Y KRTAP4-11 n/a
9 TRCN0000160139 CCAATCCTCTAAATTCCTCAT pLKO.1 908 3UTR 100% 4.050 2.025 Y KRTAP4-11 n/a
10 TRCN0000162366 CTCTGTGAGAACATTCTGGTT pLKO.1 798 3UTR 100% 2.640 1.320 Y KRTAP4-11 n/a
11 TRCN0000271986 TGTGCTGCCAGCCCACTTGTT pLKO_005 336 CDS 100% 1.650 0.825 Y Gm11554 n/a
12 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 187 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033059.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04297 pDONR223 100% 88.4% 83.4% None (many diffs) n/a
2 ccsbBroad304_04297 pLX_304 0% 88.4% 83.4% V5 (many diffs) n/a
3 TRCN0000468341 CATGCCGTACGCCCACATCGATGC pLX_317 62.9% 88.4% 83.4% V5 (many diffs) n/a
4 ccsbBroadEn_04474 pDONR223 100% 63.1% 56.9% None (many diffs) n/a
5 ccsbBroad304_04474 pLX_304 0% 63.1% 56.9% V5 (many diffs) n/a
6 TRCN0000480629 TACACATACCCGTACACGGAGCCC pLX_317 96.2% 63.1% 56.9% V5 (many diffs) n/a
Download CSV