Transcript: Human NM_033141.4

Homo sapiens mitogen-activated protein kinase kinase kinase 9 (MAP3K9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K9 (4293)
Length:
11553
CDS:
343..3699

Additional Resources:

NCBI RefSeq record:
NM_033141.4
NBCI Gene record:
MAP3K9 (4293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148079 CTTAGCAGTCGCTTATGGAG pXPR_003 TGG 1078 32% 4 0.2949 MAP3K9 MAP3K9 77307
2 BRDN0001145934 GCAGGAACTTCGCACCTGGG pXPR_003 AGG 1339 40% 6 0.2913 MAP3K9 MAP3K9 77310
3 BRDN0001145380 CTGCTTATATCCATCTACCA pXPR_003 GGG 1927 57% 10 0.227 MAP3K9 MAP3K9 77308
4 BRDN0001146157 TGCTGGACTTAAGGTCGCGG pXPR_003 TGG 800 24% 2 -0.2643 MAP3K9 MAP3K9 77309
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033141.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273820 ACGACCATCTTTCACGAATAT pLKO_005 1518 CDS 100% 13.200 18.480 N MAP3K9 n/a
2 TRCN0000273878 ACAACTGGAAACACGAGATTC pLKO_005 1613 CDS 100% 10.800 15.120 N MAP3K9 n/a
3 TRCN0000021495 CCGCCCATTCAGTTGTTAGAA pLKO.1 736 CDS 100% 5.625 4.500 N MAP3K9 n/a
4 TRCN0000273819 GTCCCTGGTAGATGGATATAA pLKO_005 2262 CDS 100% 15.000 10.500 N MAP3K9 n/a
5 TRCN0000021497 CCCATCAGAATCTCCACATTT pLKO.1 2226 CDS 100% 13.200 9.240 N MAP3K9 n/a
6 TRCN0000021494 CCCTACTTCTTGCACTGATAA pLKO.1 3798 3UTR 100% 13.200 9.240 N MAP3K9 n/a
7 TRCN0000196631 GACCTTTGAATAGAGTGTTAT pLKO.1 1019 CDS 100% 13.200 9.240 N MAP3K9 n/a
8 TRCN0000021498 GATTCTGAAGATCACTGATTT pLKO.1 1206 CDS 100% 13.200 9.240 N MAP3K9 n/a
9 TRCN0000273877 TGGATATTCTGTGATTGATTT pLKO_005 4117 3UTR 100% 13.200 9.240 N MAP3K9 n/a
10 TRCN0000195694 CCAGAGGGATGAACTACTTAC pLKO.1 1091 CDS 100% 10.800 7.560 N MAP3K9 n/a
11 TRCN0000194909 CCTTGCTTTATGAGCCCATTA pLKO.1 5381 3UTR 100% 10.800 7.560 N MAP3K9 n/a
12 TRCN0000194928 CCTTTGGTCTTCACTCTAATC pLKO.1 4659 3UTR 100% 10.800 7.560 N MAP3K9 n/a
13 TRCN0000196575 GCGATGAAATTGTCGTGTATG pLKO.1 2945 CDS 100% 10.800 7.560 N MAP3K9 n/a
14 TRCN0000273875 GCGATGAAATTGTCGTGTATG pLKO_005 2945 CDS 100% 10.800 7.560 N MAP3K9 n/a
15 TRCN0000021496 GCGCTTCAAACGAGATCCTAA pLKO.1 3042 CDS 100% 4.950 3.465 N MAP3K9 n/a
16 TRCN0000362465 ACCTTAAGTCCAGCAACATAT pLKO_005 1145 CDS 100% 13.200 7.920 N Map3k9 n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5844 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033141.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10970 pDONR223 100% 98.7% 98.7% None 18G>A;2026_2067del n/a
2 ccsbBroad304_10970 pLX_304 0% 98.7% 98.7% V5 18G>A;2026_2067del n/a
3 TRCN0000466870 TTCTAAGGTTTTCCACCGATTGAC pLX_317 10.3% 98.7% 98.7% V5 18G>A;2026_2067del n/a
4 TRCN0000491286 CGCCGTCACCATTGCTGTGGGGGC pLX_317 11.5% 94.8% 98.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV