Transcript: Human NM_033410.4

Homo sapiens zinc finger protein 764 (ZNF764), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF764 (92595)
Length:
2849
CDS:
193..1419

Additional Resources:

NCBI RefSeq record:
NM_033410.4
NBCI Gene record:
ZNF764 (92595)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017708 GTGGCGAAATGTCAGACACAA pLKO.1 472 CDS 100% 4.950 3.960 N ZNF764 n/a
2 TRCN0000433361 TGACCCTCCCAGAACACAATA pLKO_005 1776 3UTR 100% 13.200 9.240 N ZNF764 n/a
3 TRCN0000429261 AGTCTGATCTTGGGCCCTTAG pLKO_005 1545 3UTR 100% 6.000 4.200 N ZNF764 n/a
4 TRCN0000421514 GCAACAAGCCAGCTCTCATCT pLKO_005 398 CDS 100% 4.950 3.465 N ZNF764 n/a
5 TRCN0000017709 GCCAAACACCAGTGGGTTCAT pLKO.1 1267 CDS 100% 4.950 3.465 N ZNF764 n/a
6 TRCN0000428655 TGGTGTGAACAGGGCTAACTG pLKO_005 1872 3UTR 100% 4.950 3.465 N ZNF764 n/a
7 TRCN0000425210 ACACAAACGGACCCAGCAGAT pLKO_005 487 CDS 100% 4.050 2.835 N ZNF764 n/a
8 TRCN0000432408 CGGAGATATTCCAGGAGTGTG pLKO_005 1394 CDS 100% 4.050 2.835 N ZNF764 n/a
9 TRCN0000017711 CTACAGTCACACTGGCGAGAA pLKO.1 774 CDS 100% 4.050 2.835 N ZNF764 n/a
10 TRCN0000429766 AGAAGTCAGCCGTGGCCAAAC pLKO_005 1253 CDS 100% 2.000 1.400 N ZNF764 n/a
11 TRCN0000017712 CGCTCTCGGAATCGGAGGCAA pLKO.1 381 CDS 100% 0.000 0.000 N ZNF764 n/a
12 TRCN0000017710 CCCAGCAGATTCCAGAAACAA pLKO.1 498 CDS 100% 5.625 2.813 Y ZNF764 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2250 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09344 pDONR223 100% 99.9% 99.7% None 995C>T n/a
2 ccsbBroad304_09344 pLX_304 0% 99.9% 99.7% V5 995C>T n/a
3 TRCN0000467045 ATTCCTTGAAGTCGGTAGCTTGTG pLX_317 26.6% 99.9% 99.7% V5 995C>T n/a
4 ccsbBroadEn_04001 pDONR223 100% 26.9% 20.3% None (many diffs) n/a
5 ccsbBroad304_04001 pLX_304 0% 26.9% 20.3% V5 (many diffs) n/a
6 TRCN0000491881 ATGTTTATACCCAGTGGGACCTTG pLX_317 57.5% 26.9% 20.3% V5 (many diffs) n/a
Download CSV