Transcript: Mouse NM_033569.3

Mus musculus cyclin M2 (Cnnm2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cnnm2 (94219)
Length:
3330
CDS:
165..2792

Additional Resources:

NCBI RefSeq record:
NM_033569.3
NBCI Gene record:
Cnnm2 (94219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219595 ATCATCGAGATCGAGATTAAA pLKO.1 678 CDS 100% 15.000 21.000 N Cnnm2 n/a
2 TRCN0000201923 CGTAGACTACTTCGTCCTCAT pLKO.1 2210 CDS 100% 4.050 5.670 N Cnnm2 n/a
3 TRCN0000189585 CGCTTCTTATCCGGTTAGCAA pLKO.1 1328 CDS 100% 3.000 4.200 N Cnnm2 n/a
4 TRCN0000189919 GCAAGTGATCTTCATCTCGCT pLKO.1 935 CDS 100% 0.660 0.924 N Cnnm2 n/a
5 TRCN0000452962 CGCTATGCTGGAAGAATTTAA pLKO_005 1760 CDS 100% 15.000 12.000 N CNNM2 n/a
6 TRCN0000191314 CGTTTCTTTCATCCCTCAATT pLKO.1 3053 3UTR 100% 13.200 9.240 N Cnnm2 n/a
7 TRCN0000200656 CCACCCAAATAGAATCATGTT pLKO.1 3011 3UTR 100% 4.950 3.465 N Cnnm2 n/a
8 TRCN0000192479 CCTGCTCTTTGTCAAAGACTT pLKO.1 1643 CDS 100% 4.950 3.465 N Cnnm2 n/a
9 TRCN0000189856 GCATCGTCATCTTCGGAGAAA pLKO.1 1216 CDS 100% 4.950 3.465 N Cnnm2 n/a
10 TRCN0000201224 GCAGAGTTTGAAGTTGGTCTT pLKO.1 3146 3UTR 100% 4.050 2.835 N Cnnm2 n/a
11 TRCN0000202178 CCTCAGTCTTCAGACAGTGAA pLKO.1 2637 CDS 100% 4.950 2.970 N Cnnm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08409 pDONR223 100% 58.2% 59.9% None (many diffs) n/a
2 ccsbBroad304_08409 pLX_304 0% 58.2% 59.9% V5 (many diffs) n/a
3 TRCN0000480940 CATGTGCACTTAGTAGCCCGGATT pLX_317 24.7% 58.2% 59.9% V5 (many diffs) n/a
Download CSV