Transcript: Human NM_033626.3

Homo sapiens coiled-coil domain containing 120 (CCDC120), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
CCDC120 (90060)
Length:
4023
CDS:
237..2129

Additional Resources:

NCBI RefSeq record:
NM_033626.3
NBCI Gene record:
CCDC120 (90060)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166502 CCCTTCTGATATGTCCCTTGT pLKO.1 2677 3UTR 100% 4.050 3.240 N CCDC120 n/a
2 TRCN0000426376 CCACCTCCATCAGATCTTTAT pLKO_005 1029 CDS 100% 13.200 9.240 N CCDC120 n/a
3 TRCN0000165517 GCAAACCTGAAGGCCTTCATT pLKO.1 1189 CDS 100% 5.625 3.938 N CCDC120 n/a
4 TRCN0000165066 GCACTGGTAGCAGCAATTCTT pLKO.1 2300 3UTR 100% 5.625 3.938 N CCDC120 n/a
5 TRCN0000423668 GTAAGGCAGATGGCGAAGATA pLKO_005 2144 3UTR 100% 5.625 3.938 N CCDC120 n/a
6 TRCN0000158665 CCTCCATTTATGTTTACAGTT pLKO.1 2935 3UTR 100% 4.950 3.465 N CCDC120 n/a
7 TRCN0000159174 GCAGCAATTCTTTATCAAGTT pLKO.1 2309 3UTR 100% 4.950 3.465 N CCDC120 n/a
8 TRCN0000165729 CCTCTTGGACTATTCCTTGGA pLKO.1 1565 CDS 100% 2.640 1.848 N CCDC120 n/a
9 TRCN0000240867 GAGACTTCCTCTTGGACTATC pLKO_005 1558 CDS 100% 10.800 7.560 N Ccdc120 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3755 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3755 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04504 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04504 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474151 CCGGCAGTATCTGTGATATCTACG pLX_317 16% 100% 100% V5 n/a
Download CSV