Transcript: Human NM_033637.4

Homo sapiens beta-transducin repeat containing E3 ubiquitin protein ligase (BTRC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
BTRC (8945)
Length:
6024
CDS:
17..1834

Additional Resources:

NCBI RefSeq record:
NM_033637.4
NBCI Gene record:
BTRC (8945)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033637.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314900 ACTTGCCCAGGACCCATTAAA pLKO_005 1856 3UTR 100% 15.000 21.000 N BTRC n/a
2 TRCN0000006543 GCGTTGTATTCGATTTGATAA pLKO.1 1543 CDS 100% 13.200 18.480 N BTRC n/a
3 TRCN0000314899 GCGTTGTATTCGATTTGATAA pLKO_005 1543 CDS 100% 13.200 18.480 N BTRC n/a
4 TRCN0000314901 TTACCAACATGGGCACATAAA pLKO_005 502 CDS 100% 13.200 10.560 N BTRC n/a
5 TRCN0000006541 CCATTAAAGTTGCGGTATTTA pLKO.1 1869 3UTR 100% 15.000 10.500 N BTRC n/a
6 TRCN0000314972 AGATGTGGAAGACATAGTTTA pLKO_005 875 CDS 100% 13.200 9.240 N BTRC n/a
7 TRCN0000006542 GCACATAAACTCGTATCTTAA pLKO.1 514 CDS 100% 13.200 9.240 N BTRC n/a
8 TRCN0000006544 GCGTTTCAATAATGGCATGAT pLKO.1 1183 CDS 100% 4.950 3.465 N BTRC n/a
9 TRCN0000006545 GCTGAACTTGTGTGCAAGGAA pLKO.1 638 CDS 100% 3.000 2.100 N BTRC n/a
10 TRCN0000314969 GCTGAACTTGTGTGCAAGGAA pLKO_005 638 CDS 100% 3.000 2.100 N BTRC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033637.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02053 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02053 pLX_304 34.3% 100% 100% V5 n/a
3 TRCN0000469234 CAGCAAGAGATGAGACCATGAATA pLX_317 16% 100% 100% V5 n/a
Download CSV