Transcript: Human NM_033656.4

Homo sapiens bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BRWD1 (54014)
Length:
17728
CDS:
142..6951

Additional Resources:

NCBI RefSeq record:
NM_033656.4
NBCI Gene record:
BRWD1 (54014)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358427 ACTCGAAAGAGAGTCTATTTA pLKO_005 4933 CDS 100% 15.000 21.000 N BRWD1 n/a
2 TRCN0000368527 CTGACTATCGACCACTTATTA pLKO_005 1826 CDS 100% 15.000 21.000 N BRWD1 n/a
3 TRCN0000062665 GCTGATATTTAGCAATGCAAA pLKO.1 4290 CDS 100% 4.950 3.960 N BRWD1 n/a
4 TRCN0000062667 CGGACATCTATCTGCTGTTTA pLKO.1 690 CDS 100% 13.200 9.240 N BRWD1 n/a
5 TRCN0000062664 GCCGCTTGTTATCTACATTAA pLKO.1 794 CDS 100% 13.200 9.240 N BRWD1 n/a
6 TRCN0000062663 GCCTGCTATAAGACTACTATT pLKO.1 16427 3UTR 100% 13.200 9.240 N BRWD1 n/a
7 TRCN0000062666 GCGTGAGTTATCTTCTGGAAA pLKO.1 2577 CDS 100% 4.950 3.465 N BRWD1 n/a
8 TRCN0000084534 GCAGCATATTTATATGGGATA pLKO.1 1613 CDS 100% 4.050 2.835 N Brwd1 n/a
9 TRCN0000301846 GCAGCATATTTATATGGGATA pLKO_005 1613 CDS 100% 4.050 2.835 N Brwd1 n/a
10 TRCN0000358426 GGACATGATGGCAGCATATTT pLKO_005 1603 CDS 100% 15.000 9.000 N BRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08359 pDONR223 100% 5.1% 5% None (many diffs) n/a
2 ccsbBroad304_08359 pLX_304 0% 5.1% 5% V5 (many diffs) n/a
3 TRCN0000475291 CCAGAAATCCATACCTAACTATTT pLX_317 100% 5.1% 5% V5 (many diffs) n/a
Download CSV