Transcript: Human NM_052934.4

Homo sapiens solute carrier family 26 member 9 (SLC26A9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC26A9 (115019)
Length:
4791
CDS:
111..2486

Additional Resources:

NCBI RefSeq record:
NM_052934.4
NBCI Gene record:
SLC26A9 (115019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044050 CCCAGGTGTACAATGACATTA pLKO.1 2221 CDS 100% 13.200 18.480 N SLC26A9 n/a
2 TRCN0000296823 GTCACGGACATAGGGATAAAC pLKO_005 2939 3UTR 100% 13.200 18.480 N SLC26A9 n/a
3 TRCN0000044052 GATCCTGATTTCGGTGCTCAA pLKO.1 752 CDS 100% 4.050 3.240 N SLC26A9 n/a
4 TRCN0000291285 GATCCTGATTTCGGTGCTCAA pLKO_005 752 CDS 100% 4.050 3.240 N SLC26A9 n/a
5 TRCN0000296885 GTGAATCCCAAGACCTATAAT pLKO_005 1653 CDS 100% 15.000 10.500 N SLC26A9 n/a
6 TRCN0000296821 TCTTTACCTTCATTGACATTT pLKO_005 823 CDS 100% 13.200 9.240 N SLC26A9 n/a
7 TRCN0000296819 TAGAATGCAAGCACGTCTTTC pLKO_005 2272 CDS 100% 10.800 7.560 N SLC26A9 n/a
8 TRCN0000044048 GCTCGCTACATGCACAAGATT pLKO.1 930 CDS 100% 5.625 3.938 N SLC26A9 n/a
9 TRCN0000044051 GTGGGAGAGAAACTTCGCAAT pLKO.1 207 CDS 100% 4.050 2.835 N SLC26A9 n/a
10 TRCN0000044049 CCAGAAAGTATTACTAGCCAA pLKO.1 1784 CDS 100% 2.640 1.848 N SLC26A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09411 pDONR223 100% 99.9% 99.8% None 192G>C n/a
2 ccsbBroad304_09411 pLX_304 0% 99.9% 99.8% V5 192G>C n/a
3 TRCN0000476089 GGCGACATTGCGCTGAAATTTATA pLX_317 13.2% 99.9% 99.8% V5 192G>C n/a
Download CSV