Transcript: Human NM_052947.4

Homo sapiens alpha kinase 2 (ALPK2), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ALPK2 (115701)
Length:
7437
CDS:
349..6861

Additional Resources:

NCBI RefSeq record:
NM_052947.4
NBCI Gene record:
ALPK2 (115701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052947.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021389 CCTCACATCATGTGTATATTT pLKO.1 7139 3UTR 100% 15.000 21.000 N ALPK2 n/a
2 TRCN0000230561 GTTATGACGGATTACTCTAAT pLKO_005 1351 CDS 100% 13.200 18.480 N ALPK2 n/a
3 TRCN0000360804 GTTATGACGGATTACTCTAAT pLKO_005 1351 CDS 100% 13.200 18.480 N Alpk2 n/a
4 TRCN0000196357 GTACCTGAGATCATTCCTATT pLKO.1 6370 CDS 100% 0.000 0.000 N ALPK2 n/a
5 TRCN0000230560 ATCGATGGGAGTGGCATTATT pLKO_005 502 CDS 100% 15.000 12.000 N ALPK2 n/a
6 TRCN0000021391 GCGAAGACCTTGGCATTTATT pLKO.1 5296 CDS 100% 15.000 12.000 N ALPK2 n/a
7 TRCN0000230559 CGCTGTGCTTCGCTGCATAAT pLKO_005 432 CDS 100% 13.200 10.560 N ALPK2 n/a
8 TRCN0000230562 TCAAGTCGCCAGGATACTAAA pLKO_005 5992 CDS 100% 13.200 10.560 N ALPK2 n/a
9 TRCN0000196836 GCATGCAAGTTAATACTCTAT pLKO.1 2249 CDS 100% 4.950 3.960 N ALPK2 n/a
10 TRCN0000218967 CAACCTCACATCATGTGTATA pLKO_005 7136 3UTR 100% 13.200 9.240 N ALPK2 n/a
11 TRCN0000199403 CTGAGGCAACTGCACACATTT pLKO.1 1178 CDS 100% 13.200 9.240 N ALPK2 n/a
12 TRCN0000194883 CCAACAACATTAACTGCTAAT pLKO.1 3313 CDS 100% 10.800 7.560 N ALPK2 n/a
13 TRCN0000021393 CCCAAAGTACAGAAATACATT pLKO.1 1138 CDS 100% 5.625 3.938 N ALPK2 n/a
14 TRCN0000197061 GCAGACTTTAGGAGCTATGAA pLKO.1 3697 CDS 100% 5.625 3.938 N ALPK2 n/a
15 TRCN0000021390 CCTGAGAACAATATCCCGTAT pLKO.1 6406 CDS 100% 4.050 2.835 N ALPK2 n/a
16 TRCN0000021392 CCTCAGGTACAAGTTCAGGAA pLKO.1 2305 CDS 100% 2.640 1.848 N ALPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052947.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15227 pDONR223 27.8% 88.7% 12.3% None (many diffs) n/a
2 ccsbBroad304_15227 pLX_304 0% 88.7% 12.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467624 CACATTAATACTTGACATGAGCAA pLX_317 4% 88.7% 12.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV