Transcript: Mouse NM_053009.3

Mus musculus zinc finger protein 91 (Zfp91), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zfp91 (109910)
Length:
5624
CDS:
791..2509

Additional Resources:

NCBI RefSeq record:
NM_053009.3
NBCI Gene record:
Zfp91 (109910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218723 GAGAGCTAGTGCTAGTATAAT pLKO_005 4877 3UTR 100% 15.000 21.000 N Zfp91 n/a
2 TRCN0000234173 CTGGTCATGAACTCGGATATA pLKO_005 2435 CDS 100% 13.200 9.240 N Zfp91 n/a
3 TRCN0000234174 CTACCACAGAGGTTCTGATTG pLKO_005 2463 CDS 100% 10.800 7.560 N Zfp91 n/a
4 TRCN0000234175 CTACTGGACCCTAGTGCAAAG pLKO_005 2496 CDS 100% 6.000 4.200 N Zfp91 n/a
5 TRCN0000234172 TGGCTGACGGGAAGATCTTTG pLKO_005 2382 CDS 100% 10.800 6.480 N Zfp91 n/a
6 TRCN0000018074 CGCTATTTGCAGCACCACATT pLKO.1 1772 CDS 100% 4.950 2.475 Y ZFP91 n/a
7 TRCN0000274883 CGCTATTTGCAGCACCACATT pLKO_005 1772 CDS 100% 4.950 2.475 Y ZFP91 n/a
8 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1424 CDS 100% 4.950 2.475 Y PTMA n/a
9 TRCN0000018077 GCAGACTCCTTCTACCAGTTT pLKO.1 2066 CDS 100% 4.950 2.475 Y ZFP91 n/a
10 TRCN0000274821 GCAGACTCCTTCTACCAGTTT pLKO_005 2066 CDS 100% 4.950 2.475 Y ZFP91 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15172 pDONR223 98.6% 90.2% 91.4% None (many diffs) n/a
2 ccsbBroad304_15172 pLX_304 0% 90.2% 91.4% V5 (many diffs) n/a
3 TRCN0000473036 GTATGCACTTAATAACCCTCGCGT pLX_317 28.6% 90.2% 91.4% V5 (many diffs) n/a
Download CSV