Transcript: Mouse NM_053079.2

Mus musculus solute carrier family 15 (oligopeptide transporter), member 1 (Slc15a1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc15a1 (56643)
Length:
3123
CDS:
33..2162

Additional Resources:

NCBI RefSeq record:
NM_053079.2
NBCI Gene record:
Slc15a1 (56643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079687 GTGGAAATCAAGTCCAAATTA pLKO.1 1204 CDS 100% 15.000 21.000 N Slc15a1 n/a
2 TRCN0000079685 GCGGCTCATCTCACAGATTAA pLKO.1 845 CDS 100% 13.200 9.240 N Slc15a1 n/a
3 TRCN0000079686 CCAGTCAATACCGTGTGGTAA pLKO.1 1435 CDS 100% 4.950 3.465 N Slc15a1 n/a
4 TRCN0000079684 CGGCAATATCATTGTGCTCAT pLKO.1 1919 CDS 100% 4.050 2.835 N Slc15a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06967 pDONR223 100% 83.3% 85% None (many diffs) n/a
2 ccsbBroad304_06967 pLX_304 0% 83.3% 85% V5 (many diffs) n/a
3 TRCN0000471681 AACAGATAGCAAAAAACGACCTCT pLX_317 19.6% 83.3% 85% V5 (many diffs) n/a
Download CSV