Transcript: Mouse NM_053246.3

Mus musculus docking protein 4 (Dok4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dok4 (114255)
Length:
2604
CDS:
326..1303

Additional Resources:

NCBI RefSeq record:
NM_053246.3
NBCI Gene record:
Dok4 (114255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247017 CCCTGCTGAAATGCAATTAAA pLKO_005 2161 3UTR 100% 15.000 10.500 N Dok4 n/a
2 TRCN0000247019 AGCAGGAAGCTCGGGATTTAC pLKO_005 377 CDS 100% 13.200 9.240 N Dok4 n/a
3 TRCN0000247015 ACATCTACCTCTGGGACATAC pLKO_005 813 CDS 100% 10.800 7.560 N Dok4 n/a
4 TRCN0000247016 GAACAGGTTCATCTTGCTTAA pLKO_005 1231 CDS 100% 10.800 7.560 N Dok4 n/a
5 TRCN0000247018 TCACAGGTTCTCAGAACATTG pLKO_005 1146 CDS 100% 10.800 7.560 N Dok4 n/a
6 TRCN0000136733 GAACATCTACCTCTGGGACAT pLKO.1 811 CDS 100% 4.050 2.835 N DOK4 n/a
7 TRCN0000319105 GAACATCTACCTCTGGGACAT pLKO_005 811 CDS 100% 4.050 2.835 N DOK4 n/a
8 TRCN0000183169 GTTCATCTTGCTTAAGCCAAA pLKO.1 1237 CDS 100% 4.050 2.835 N Dok4 n/a
9 TRCN0000179058 CCATCATATTCACAGACGACT pLKO.1 567 CDS 100% 2.640 1.848 N Dok4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03637 pDONR223 100% 91% 98.1% None (many diffs) n/a
2 ccsbBroad304_03637 pLX_304 0% 91% 98.1% V5 (many diffs) n/a
3 TRCN0000469150 CTGTCAAGGCCTGTTGGTCGCTAA pLX_317 35.9% 91% 98.1% V5 (many diffs) n/a
Download CSV