Transcript: Human NM_054012.4

Homo sapiens argininosuccinate synthase 1 (ASS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
ASS1 (445)
Length:
1532
CDS:
41..1279

Additional Resources:

NCBI RefSeq record:
NM_054012.4
NBCI Gene record:
ASS1 (445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_054012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440576 CCCAAGTACAGGCGCTAATTG pLKO_005 1325 3UTR 100% 13.200 18.480 N ASS1 n/a
2 TRCN0000045554 GCCTGAATTCTACAACCGGTT pLKO.1 481 CDS 100% 0.000 0.000 N ASS1 n/a
3 TRCN0000436210 ATGAACGTGCAGGGTGATTAT pLKO_005 1169 CDS 100% 13.200 9.240 N ASS1 n/a
4 TRCN0000437923 GAGCAAGGTCACTGCCAAATA pLKO_005 1258 CDS 100% 13.200 9.240 N Ass1 n/a
5 TRCN0000443685 ACGCAAAGCAACACGGGATTC pLKO_005 528 CDS 100% 6.000 4.200 N ASS1 n/a
6 TRCN0000045556 CTCAGGCTGAAGGAATATCAT pLKO.1 1229 CDS 100% 5.625 3.938 N ASS1 n/a
7 TRCN0000045553 CCATCCTTTACCATGCTCATT pLKO.1 903 CDS 100% 4.950 3.465 N ASS1 n/a
8 TRCN0000075722 TGGCTGAAGGAACAAGGCTAT pLKO.1 107 CDS 100% 4.050 2.835 N Ass1 n/a
9 TRCN0000045557 CAGAAGGAAGACTTCGAGGAA pLKO.1 158 CDS 100% 2.640 1.848 N ASS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00116 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00116 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467990 CCTCTCAAATCGAGATCTGATGTC pLX_317 27.8% 100% 100% V5 n/a
4 ccsbBroadEn_05861 pDONR223 100% 99.9% 100% None 876T>C n/a
5 ccsbBroad304_05861 pLX_304 0% 99.9% 100% V5 876T>C n/a
6 TRCN0000465353 ACTAATAACATTGGTCCGTTAACG pLX_317 19.2% 99.9% 100% V5 876T>C n/a
Download CSV