Transcript: Human NM_054021.1

Homo sapiens G protein-coupled receptor 101 (GPR101), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GPR101 (83550)
Length:
1527
CDS:
1..1527

Additional Resources:

NCBI RefSeq record:
NM_054021.1
NBCI Gene record:
GPR101 (83550)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_054021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011505 CGCGGTTACCTGCTCCTCTAT pLKO.1 439 CDS 100% 1.650 1.320 N GPR101 n/a
2 TRCN0000357067 CCAGTGGGTGATCACCATAAT pLKO_005 1296 CDS 100% 13.200 9.240 N GPR101 n/a
3 TRCN0000357066 TCATCGTCATTCCACTGATTG pLKO_005 599 CDS 100% 10.800 7.560 N GPR101 n/a
4 TRCN0000011503 CATGCACAAGACCATTAAGAA pLKO.1 1368 CDS 100% 5.625 3.938 N GPR101 n/a
5 TRCN0000011504 GTGGTGTCCTTCATCGTCATT pLKO.1 589 CDS 100% 4.950 3.465 N GPR101 n/a
6 TRCN0000011506 CCCAGGTGCTACCAGTGCAAA pLKO.1 1168 CDS 100% 1.650 1.155 N GPR101 n/a
7 TRCN0000011507 CGCCTCTTTCGTCGGCAACAT pLKO.1 129 CDS 100% 1.650 1.155 N GPR101 n/a
8 TRCN0000234966 CAGTGGGTGATCACCATAATA pLKO_005 1297 CDS 100% 15.000 12.000 N Gpr101 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489724 AAGAATATAATATTCACCAGGGTA pLX_317 24.2% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489037 TTGACCCATTGCCTCTATGAAGTT pLX_317 24.1% 99.9% 99.8% V5 (not translated due to prior stop codon) 370G>T n/a
3 TRCN0000488339 GCTGTTAGTAGAAACTGTTGTCGG pLX_317 19.5% 99.8% 99.6% V5 370G>T;1524_1525insG n/a
4 TRCN0000489530 AAACCCTCACTGATATCACTGTCC pLX_317 23.5% 99.8% 99.8% V5 1269G>A;1524_1525insG n/a
5 ccsbBroadEn_09100 pDONR223 100% 99.8% 99.8% None 667C>T;1350C>T n/a
6 ccsbBroad304_09100 pLX_304 0% 99.8% 99.8% V5 667C>T;1350C>T n/a
7 TRCN0000476087 TTTCGACCTCCCATAAAGGGCGCA pLX_317 24% 99.8% 99.8% V5 667C>T;1350C>T n/a
Download CSV