Transcript: Mouse NM_054071.2

Mus musculus fibroblast growth factor receptor-like 1 (Fgfrl1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Fgfrl1 (116701)
Length:
2656
CDS:
462..2051

Additional Resources:

NCBI RefSeq record:
NM_054071.2
NBCI Gene record:
Fgfrl1 (116701)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078860 CTCATCATCATGGATGATATT pLKO.1 789 CDS 100% 1.320 1.848 N Fgfrl1 n/a
2 TRCN0000078861 GCCAGACATCATGTGGATGAA pLKO.1 986 CDS 100% 4.950 3.960 N Fgfrl1 n/a
3 TRCN0000078858 GCCATATAGATGTATGTACTA pLKO.1 2082 3UTR 100% 4.950 3.960 N Fgfrl1 n/a
4 TRCN0000078862 TGTCCACTATCAGTGCTAAAT pLKO.1 1935 CDS 100% 13.200 9.240 N Fgfrl1 n/a
5 TRCN0000078859 CCACCTACAAAGTGGATGTAA pLKO.1 1144 CDS 100% 5.625 3.938 N Fgfrl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054071.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03396 pDONR223 100% 78.1% 78.4% None (many diffs) n/a
2 ccsbBroad304_03396 pLX_304 0% 78.1% 78.4% V5 (many diffs) n/a
3 TRCN0000465318 TAAAACCAATTAGCCTCCCGTGAG pLX_317 5.4% 78.1% 78.4% V5 (many diffs) n/a
4 ccsbBroadEn_15078 pDONR223 0% 78.1% 78.4% None (many diffs) n/a
5 ccsbBroad304_15078 pLX_304 0% 78.1% 78.4% V5 (many diffs) n/a
6 TRCN0000468902 TGCGTTATCAATCCAACCAGAGTG pLX_317 13.7% 78.1% 78.4% V5 (many diffs) n/a
7 ccsbBroadEn_12026 pDONR223 100% 54.5% 53.9% None (many diffs) n/a
8 ccsbBroad304_12026 pLX_304 0% 54.5% 53.9% V5 (many diffs) n/a
9 TRCN0000479989 GTGTTCTATATCCATCTATCCCTC pLX_317 15.8% 54.5% 53.9% V5 (many diffs) n/a
Download CSV