Transcript: Human NM_058195.3

Homo sapiens cyclin dependent kinase inhibitor 2A (CDKN2A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-12
Taxon:
Homo sapiens (human)
Gene:
CDKN2A (1029)
Length:
1164
CDS:
161..559

Additional Resources:

NCBI RefSeq record:
NM_058195.3
NBCI Gene record:
CDKN2A (1029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_058195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039748 CGCACATTCATGTGGGCATTT pLKO.1 970 3UTR 100% 10.800 15.120 N CDKN2A n/a
2 TRCN0000281415 AGTAACCATGCCCGCATAGAT pLKO_005 621 3UTR 100% 5.625 7.875 N CDKN2A n/a
3 TRCN0000255850 ATCAGTCACCGAAGGTCCTAC pLKO_005 717 3UTR 100% 4.050 5.670 N CDKN2A n/a
4 TRCN0000255849 GCTCTGAGAAACCTCGGGAAA pLKO_005 688 3UTR 100% 4.050 3.240 N CDKN2A n/a
5 TRCN0000255853 CACTACCGTAAATGTCCATTT pLKO_005 846 3UTR 100% 10.800 7.560 N CDKN2A n/a
6 TRCN0000265700 CCTCGGGAAACTTAGATCATC pLKO_005 699 3UTR 100% 4.950 3.465 N CDKN2A n/a
7 TRCN0000010483 GCCCTAAGCGCACATTCATGT pLKO.1 962 3UTR 100% 4.950 3.465 N CDKN2A n/a
8 TRCN0000265833 CCGATTGAAAGAACCAGAGAG pLKO_005 667 3UTR 100% 4.050 2.835 N CDKN2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_058195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10727 pDONR223 100% 39.1% 18.2% None 1_196del;396_397ins115 n/a
2 ccsbBroad304_10727 pLX_304 0% 39.1% 18.2% V5 1_196del;396_397ins115 n/a
3 TRCN0000472814 GGACATTGCTGCCATTCTGAACGC pLX_317 87.1% 39.1% 18.2% V5 1_196del;396_397ins115 n/a
Download CSV