Transcript: Human NM_058230.3

Homo sapiens zinc finger protein 354B (ZNF354B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ZNF354B (117608)
Length:
2794
CDS:
227..2065

Additional Resources:

NCBI RefSeq record:
NM_058230.3
NBCI Gene record:
ZNF354B (117608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_058230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422849 GTTTAGAATGTGGGATGTCTT pLKO_005 1797 CDS 100% 4.950 3.960 N ZNF354B n/a
2 TRCN0000430891 CATTGAAGAGGACTCCTTAAA pLKO_005 2026 CDS 100% 13.200 9.240 N ZNF354B n/a
3 TRCN0000018967 CCTGCATATATGAAGAGAAAT pLKO.1 597 CDS 100% 13.200 9.240 N ZNF354B n/a
4 TRCN0000423157 GAGAAATGCTATAGATGTAAA pLKO_005 1109 CDS 100% 13.200 9.240 N ZNF354B n/a
5 TRCN0000429824 CAGTTACAGCACTTCCCTTTC pLKO_005 1231 CDS 100% 6.000 4.200 N ZNF354B n/a
6 TRCN0000424025 TGGGACTCTCATTTACCAAAC pLKO_005 384 CDS 100% 6.000 4.200 N ZNF354B n/a
7 TRCN0000018964 CCATAGTGCATCCCTTTGTAA pLKO.1 1066 CDS 100% 5.625 3.938 N ZNF354B n/a
8 TRCN0000423207 GCAACAGAGATTTGCTAAAGA pLKO_005 751 CDS 100% 5.625 3.938 N ZNF354B n/a
9 TRCN0000018968 CTACCTGAAATCAGTCTTCAT pLKO.1 727 CDS 100% 4.950 3.465 N ZNF354B n/a
10 TRCN0000426716 ATCTCAGAAAGAAGTCCTACT pLKO_005 1269 CDS 100% 4.050 2.835 N ZNF354B n/a
11 TRCN0000415188 TTACCTGGGATGAGTGGAGAA pLKO_005 294 CDS 100% 4.050 2.835 N ZNF354B n/a
12 TRCN0000414016 ACTCAAACTCAGGATTCATTT pLKO_005 515 CDS 100% 13.200 7.920 N ZNF354B n/a
13 TRCN0000018966 CATCACTTATTGCACATCAAA pLKO.1 1914 CDS 100% 5.625 3.375 N ZNF354B n/a
14 TRCN0000417332 TAATTTCAGTTGCCCATACAA pLKO_005 654 CDS 100% 5.625 3.375 N ZNF354B n/a
15 TRCN0000018965 CCCTGGAACTTCATATCAGAA pLKO.1 572 CDS 100% 4.950 2.970 N ZNF354B n/a
16 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1017 CDS 100% 10.800 5.400 Y Gm14308 n/a
17 TRCN0000235219 ACAGGAGAGAAACCCTATAAA pLKO_005 1019 CDS 100% 15.000 7.500 Y LOC66376 n/a
18 TRCN0000235327 ACAGGAGAGAAACCCTATAAA pLKO_005 1019 CDS 100% 15.000 7.500 Y OTTMUSG00000016228 n/a
19 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1018 CDS 100% 13.200 6.600 Y Gm14305 n/a
20 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1945 CDS 100% 13.200 6.600 Y Zfp977 n/a
21 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1352 CDS 100% 6.000 3.000 Y Zfp612 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_058230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07038 pDONR223 100% 88.8% 84.8% None (many diffs) n/a
2 ccsbBroad304_07038 pLX_304 0% 88.8% 84.8% V5 (many diffs) n/a
3 TRCN0000478640 TACATCAATAACCCCTTTTATCCG pLX_317 16% 88.8% 84.8% V5 (many diffs) n/a
Download CSV