Transcript: Mouse NM_080438.2

Mus musculus glycine receptor, alpha 3 subunit (Glra3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Glra3 (110304)
Length:
1474
CDS:
32..1474

Additional Resources:

NCBI RefSeq record:
NM_080438.2
NBCI Gene record:
Glra3 (110304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089231 CCTGACGATTCATTAGACCTT pLKO.1 413 CDS 100% 2.640 3.696 N Glra3 n/a
2 TRCN0000089228 CCACGAAGTCACCACAGATAA pLKO.1 502 CDS 100% 13.200 10.560 N Glra3 n/a
3 TRCN0000089229 CGAAGTCACCACAGATAACAA pLKO.1 505 CDS 100% 5.625 4.500 N Glra3 n/a
4 TRCN0000418195 TTCTACTGGGTTATCTATAAA pLKO_005 1415 CDS 100% 15.000 10.500 N GLRA3 n/a
5 TRCN0000089230 CCTCAATTTCTGTTGAAAGAA pLKO.1 731 CDS 100% 5.625 3.938 N Glra3 n/a
6 TRCN0000060901 GTACACAATGAATGATCTCAT pLKO.1 658 CDS 100% 4.950 3.465 N GLRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080438.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07194 pDONR223 100% 86.2% 95.6% None (many diffs) n/a
2 ccsbBroad304_07194 pLX_304 0% 86.2% 95.6% V5 (many diffs) n/a
3 TRCN0000473127 ACCTTGACTCCTCTATATGGAAAT pLX_317 28.8% 86.2% 95.6% V5 (many diffs) n/a
Download CSV