Transcript: Mouse NM_080448.4

Mus musculus SLIT-ROBO Rho GTPase activating protein 3 (Srgap3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Srgap3 (259302)
Length:
8887
CDS:
771..4070

Additional Resources:

NCBI RefSeq record:
NM_080448.4
NBCI Gene record:
Srgap3 (259302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080448.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106033 CCTCGTGAACTATCCTTCAAA pLKO.1 3048 CDS 100% 5.625 7.875 N Srgap3 n/a
2 TRCN0000106031 CGCAGCTATCAGCAAATACTA pLKO.1 1523 CDS 100% 5.625 4.500 N Srgap3 n/a
3 TRCN0000106030 CCACTCTTACTTGGTGGGATT pLKO.1 4625 3UTR 100% 4.050 3.240 N Srgap3 n/a
4 TRCN0000106032 GCCGATCTACAGAGTCCATAA pLKO.1 1984 CDS 100% 10.800 7.560 N Srgap3 n/a
5 TRCN0000106034 GCAGGCCAAGTATTCTGAGAA pLKO.1 1445 CDS 100% 4.950 3.465 N Srgap3 n/a
6 TRCN0000047564 GCTGAATATGAAGCCCAAATA pLKO.1 813 CDS 100% 13.200 7.920 N SRGAP3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5710 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080448.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11429 pDONR223 100% 27.8% 29.2% None (many diffs) n/a
2 ccsbBroad304_11429 pLX_304 0% 27.8% 29.2% V5 (many diffs) n/a
3 TRCN0000467233 TAACACCTGACTCACCTCTCTGGT pLX_317 27% 27.8% 29.2% V5 (many diffs) n/a
Download CSV