Transcript: Human NM_080475.4

Homo sapiens serpin family B member 11 (gene/pseudogene) (SERPINB11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
SERPINB11 (89778)
Length:
1915
CDS:
243..1421

Additional Resources:

NCBI RefSeq record:
NM_080475.4
NBCI Gene record:
SERPINB11 (89778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080475.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052318 CCCTACGTTAACAACAAATTA pLKO.1 951 CDS 100% 15.000 21.000 N SERPINB11 n/a
2 TRCN0000052320 CCAAGGGCCTATATTTATCAA pLKO.1 1210 CDS 100% 5.625 4.500 N SERPINB11 n/a
3 TRCN0000052322 AGTCGCAAATCTCTTTGGAAA pLKO.1 722 CDS 100% 4.950 3.960 N SERPINB11 n/a
4 TRCN0000052319 CAGTAACAACATAGGAGATAA pLKO.1 302 CDS 100% 13.200 9.240 N SERPINB11 n/a
5 TRCN0000052321 TGAGCTAAATTCCCTGTTAAA pLKO.1 1127 CDS 100% 13.200 9.240 N SERPINB11 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 25 5UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 24 5UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080475.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09272 pDONR223 100% 99.1% 98.4% None (many diffs) n/a
2 ccsbBroad304_09272 pLX_304 0% 99.1% 98.4% V5 (many diffs) n/a
3 TRCN0000476820 TATCAAACGAACTCCCGTGAATGT pLX_317 33.3% 99.1% 98.4% V5 (many diffs) n/a
4 ccsbBroadEn_12921 pDONR223 100% 70.7% 70.4% None 1_342del;506C>T;1061T>C n/a
5 ccsbBroad304_12921 pLX_304 0% 70.7% 70.4% V5 1_342del;506C>T;1061T>C n/a
6 TRCN0000467125 TTAGATGTCCGTACCCCCACATTC pLX_317 49.1% 70.7% 70.4% V5 1_342del;506C>T;1061T>C n/a
Download CSV