Transcript: Human NM_080732.4

Homo sapiens egl-9 family hypoxia inducible factor 2 (EGLN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
EGLN2 (112398)
Length:
2100
CDS:
307..1530

Additional Resources:

NCBI RefSeq record:
NM_080732.4
NBCI Gene record:
EGLN2 (112398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022324 CGCATGGCAGACAGCTTAAAT pLKO.1 1547 3UTR 100% 15.000 7.500 Y EGLN2 n/a
2 TRCN0000349633 CGCATGGCAGACAGCTTAAAT pLKO_005 1547 3UTR 100% 15.000 7.500 Y EGLN2 n/a
3 TRCN0000022325 GCTGCATCACCTGTATCTATT pLKO.1 1223 CDS 100% 13.200 6.600 Y EGLN2 n/a
4 TRCN0000318672 GCTGCATCACCTGTATCTATT pLKO_005 1223 CDS 100% 13.200 6.600 Y EGLN2 n/a
5 TRCN0000009747 GCCAACATCGAGCCACTCTTT pLKO.1 1318 CDS 100% 4.950 2.475 Y Egln2 n/a
6 TRCN0000273754 GCCAACATCGAGCCACTCTTT pLKO_005 1318 CDS 100% 4.950 2.475 Y Egln2 n/a
7 TRCN0000022327 ACTGGGACGTTAAGGTGCATG pLKO.1 1256 CDS 100% 4.050 2.025 Y EGLN2 n/a
8 TRCN0000349632 ACTGGGACGTTAAGGTGCATG pLKO_005 1256 CDS 100% 4.050 2.025 Y EGLN2 n/a
9 TRCN0000022326 GCCACTCTTTGACCGGTTGCT pLKO.1 1329 CDS 100% 0.880 0.440 Y EGLN2 n/a
10 TRCN0000318601 GCCACTCTTTGACCGGTTGCT pLKO_005 1329 CDS 100% 0.880 0.440 Y EGLN2 n/a
11 TRCN0000022328 CTGGGACGTTAAGGTGCATGG pLKO.1 1257 CDS 100% 0.750 0.375 Y EGLN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14348 pDONR223 100% 30.6% 30.4% None 1_846del;856T>G n/a
2 ccsbBroad304_14348 pLX_304 0% 30.6% 30.4% V5 1_846del;856T>G n/a
3 TRCN0000472254 GTTTATTACAACGAGACATCGATC pLX_317 90.6% 30.6% 30.4% V5 1_846del;856T>G n/a
Download CSV