Transcript: Human NM_130390.2

Homo sapiens tripartite motif containing 34 (TRIM34), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
TRIM34 (53840)
Length:
959
CDS:
78..890

Additional Resources:

NCBI RefSeq record:
NM_130390.2
NBCI Gene record:
TRIM34 (53840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130390.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005894 GCAGGACATGAGTGGAATCAT pLKO.1 824 CDS 100% 5.625 2.813 Y TRIM34 n/a
2 TRCN0000005892 CGGAGGAAGTATTCAAGGAAT pLKO.1 475 CDS 100% 4.950 2.475 Y TRIM34 n/a
3 TRCN0000005895 GTGTGGTATCAGTTACTCATT pLKO.1 251 CDS 100% 4.950 2.475 Y TRIM34 n/a
4 TRCN0000151526 CATTTGAACATCTACAGGCTA pLKO.1 268 CDS 100% 2.640 1.320 Y TRIM6-TRIM34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130390.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05690 pDONR223 100% 31.7% 30.6% None (many diffs) n/a
2 ccsbBroad304_05690 pLX_304 0% 31.7% 30.6% V5 (many diffs) n/a
3 TRCN0000477088 ATACACCGAAGCTAGGTACGCAAA pLX_317 15% 31.7% 30.6% V5 (many diffs) n/a
Download CSV