Transcript: Human NM_130463.4

Homo sapiens ATPase H+ transporting V1 subunit G2 (ATP6V1G2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ATP6V1G2 (534)
Length:
1370
CDS:
50..406

Additional Resources:

NCBI RefSeq record:
NM_130463.4
NBCI Gene record:
ATP6V1G2 (534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_130463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038387 CAACTACCGGATTTCTGCCTA pLKO.1 385 CDS 100% 2.640 3.696 N ATP6V1G2 n/a
2 TRCN0000412435 TTGTAGCAGTGATTCAGTAAG pLKO_005 885 3UTR 100% 10.800 7.560 N ATP6V1G2 n/a
3 TRCN0000038386 GCAGGCTACAAGGCGCCAGGT pLKO.1 271 CDS 100% 0.000 0.000 N ATP6V1G2 n/a
4 TRCN0000443638 GCAGATGCCAGAAAGAGGAAG pLKO_005 116 CDS 100% 4.050 2.025 Y ATP6V1G2 n/a
5 TRCN0000038384 GCACAGATGGAGGTGGAGCAA pLKO.1 167 CDS 100% 0.880 0.440 Y ATP6V1G2 n/a
6 TRCN0000038388 AGAGCACGAATTCCAGAGCAA pLKO.1 202 CDS 100% 0.000 0.000 Y ATP6V1G2 n/a
7 TRCN0000038385 CCGGCGACTGAAGCAGGCAAA pLKO.1 139 CDS 100% 0.000 0.000 Y ATP6V1G2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00139 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00139 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470033 TTCTCGCCAATTACAGACCAGTTT pLX_317 100% 100% 100% V5 n/a
Download CSV