Transcript: Mouse NM_130862.4

Mus musculus brain-specific angiogenesis inhibitor 1-associated protein 2 (Baiap2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Baiap2 (108100)
Length:
3186
CDS:
104..1672

Additional Resources:

NCBI RefSeq record:
NM_130862.4
NBCI Gene record:
Baiap2 (108100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306311 CCGGTGTACGTACTGTTATTC pLKO_005 2122 3UTR 100% 13.200 18.480 N Baiap2 n/a
2 TRCN0000079057 CTATTTCGATGCTCTGGTAAA pLKO.1 256 CDS 100% 10.800 15.120 N Baiap2 n/a
3 TRCN0000306254 GCAGCTGGCCTAGAACGTAAT pLKO_005 1208 CDS 100% 10.800 15.120 N Baiap2 n/a
4 TRCN0000079055 GCTATTTCGATGCTCTGGTAA pLKO.1 255 CDS 100% 4.950 6.930 N Baiap2 n/a
5 TRCN0000311498 CATCGATGCCATCAGCAATAA pLKO_005 595 CDS 100% 13.200 10.560 N Baiap2 n/a
6 TRCN0000079054 CGGAAGTGACAGATTGCATAT pLKO.1 1420 CDS 100% 10.800 7.560 N Baiap2 n/a
7 TRCN0000326479 CGGAAGTGACAGATTGCATAT pLKO_005 1420 CDS 100% 10.800 7.560 N Baiap2 n/a
8 TRCN0000306312 TGATGCAACAGATGGCCAATA pLKO_005 831 CDS 100% 10.800 7.560 N Baiap2 n/a
9 TRCN0000079056 CTGAAGAAATACCAAACGGAA pLKO.1 461 CDS 100% 2.640 1.848 N Baiap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11501 pDONR223 100% 87.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_11501 pLX_304 0% 87.6% 95.7% V5 (many diffs) n/a
3 TRCN0000465559 AACGTCTACCTACTGGCACAAAAC pLX_317 21.4% 87.6% 95.7% V5 (many diffs) n/a
4 ccsbBroadEn_11502 pDONR223 100% 86.1% 94% None (many diffs) n/a
5 ccsbBroad304_11502 pLX_304 0% 86.1% 94% V5 (many diffs) n/a
Download CSV