Transcript: Mouse NM_130866.4

Mus musculus olfactory receptor 78 (Olfr78), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Olfr78 (170639)
Length:
3496
CDS:
1216..2178

Additional Resources:

NCBI RefSeq record:
NM_130866.4
NBCI Gene record:
Olfr78 (170639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130866.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186389 CGGCTGTCAAATCTCTTGAAT pLKO.1 3095 3UTR 100% 5.625 7.875 N Olfr78 n/a
2 TRCN0000203977 GCTAAGGCATTTGGGACTTGT pLKO.1 1915 CDS 100% 4.950 6.930 N Olfr78 n/a
3 TRCN0000185747 GCTTTCTATGTACCACTCATT pLKO.1 1960 CDS 100% 4.950 6.930 N Olfr78 n/a
4 TRCN0000186913 GCTGTCCTCAACAATACAGTA pLKO.1 1612 CDS 100% 4.950 3.465 N Olfr78 n/a
5 TRCN0000203196 GCATTGTTTGGAAACTGCATT pLKO.1 1324 CDS 100% 4.950 2.970 N Olfr78 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130866.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09060 pDONR223 100% 86.8% 92.8% None (many diffs) n/a
2 ccsbBroad304_09060 pLX_304 0% 86.8% 92.8% V5 (many diffs) n/a
3 TRCN0000471797 TAATTTCTTGGTTCTCAACCTTCG pLX_317 45.2% 86.8% 92.8% V5 (many diffs) n/a
4 TRCN0000489165 GGCAGTTCGAACGCACTAAAATTA pLX_317 38.2% 86.7% 92.5% V5 (many diffs) n/a
5 TRCN0000489822 CTTTTACAAGCTCTGGTGAGACGT pLX_317 44.9% 86.8% 92.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV