Transcript: Mouse NM_133780.3

Mus musculus translocated promoter region, nuclear basket protein (Tpr), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tpr (108989)
Length:
7550
CDS:
107..7402

Additional Resources:

NCBI RefSeq record:
NM_133780.3
NBCI Gene record:
Tpr (108989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340972 AGCGTGACATGTACCGAATTT pLKO_005 2157 CDS 100% 13.200 18.480 N Tpr n/a
2 TRCN0000078873 CCGCAGATTGAGCCTACAAAT pLKO.1 5666 CDS 100% 13.200 18.480 N Tpr n/a
3 TRCN0000078876 CCCACTAATAAGGCTCCAGAA pLKO.1 5216 CDS 100% 4.050 5.670 N Tpr n/a
4 TRCN0000340896 CACGGAACCAGCAACTAATAA pLKO_005 4338 CDS 100% 15.000 12.000 N Tpr n/a
5 TRCN0000078874 GCTCACATAAAGCTCTCTAAT pLKO.1 1169 CDS 100% 13.200 10.560 N Tpr n/a
6 TRCN0000340970 GAGTTACCCAGGGAGATTATA pLKO_005 6006 CDS 100% 15.000 10.500 N Tpr n/a
7 TRCN0000340969 CCGACTACTTCATGATCAAAT pLKO_005 3796 CDS 100% 13.200 9.240 N Tpr n/a
8 TRCN0000340971 GGCGGAGTCTGAAGGTATTAG pLKO_005 7117 CDS 100% 13.200 9.240 N Tpr n/a
9 TRCN0000078875 CGCAGGTACAAGACTCAGTTT pLKO.1 4643 CDS 100% 4.950 3.465 N Tpr n/a
10 TRCN0000078877 GCTGACTAATCTACAGACAAT pLKO.1 2773 CDS 100% 4.950 3.465 N Tpr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14866 pDONR223 21.3% 82.4% 9.3% None (many diffs) n/a
2 ccsbBroad304_14866 pLX_304 0% 82.4% 9.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469003 GGCCATTTCGCTCCCTAATCACCC pLX_317 4.8% 82.2% 9.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV