Transcript: Mouse NM_133818.1

Mus musculus expressed sequence AI597479 (AI597479), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
AI597479 (98404)
Length:
3476
CDS:
55..753

Additional Resources:

NCBI RefSeq record:
NM_133818.1
NBCI Gene record:
AI597479 (98404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294572 CAAATTCCTCGTCGAGGATTT pLKO_005 482 CDS 100% 10.800 15.120 N AI597479 n/a
2 TRCN0000123696 GCTGTAGATGGATTAAGGAAA pLKO.1 328 CDS 100% 4.950 6.930 N AI597479 n/a
3 TRCN0000287159 GCTGTAGATGGATTAAGGAAA pLKO_005 328 CDS 100% 4.950 6.930 N AI597479 n/a
4 TRCN0000123694 CCACTTGTATAATGCAAGAAT pLKO.1 1608 3UTR 100% 5.625 3.938 N AI597479 n/a
5 TRCN0000287158 CCACTTGTATAATGCAAGAAT pLKO_005 1608 3UTR 100% 5.625 3.938 N AI597479 n/a
6 TRCN0000123697 CAGAAGAACATAGCAGTTGAA pLKO.1 151 CDS 100% 4.950 3.465 N AI597479 n/a
7 TRCN0000287156 CAGAAGAACATAGCAGTTGAA pLKO_005 151 CDS 100% 4.950 3.465 N AI597479 n/a
8 TRCN0000123695 CCATGACTTAATGAATAGGAA pLKO.1 576 CDS 100% 3.000 2.100 N AI597479 n/a
9 TRCN0000287157 CCATGACTTAATGAATAGGAA pLKO_005 576 CDS 100% 3.000 2.100 N AI597479 n/a
10 TRCN0000123698 AGAGGAAGATACAGCATGTTA pLKO.1 722 CDS 100% 5.625 3.375 N AI597479 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04039 pDONR223 100% 85.4% 85.3% None (many diffs) n/a
2 ccsbBroad304_04039 pLX_304 0% 85.4% 85.3% V5 (many diffs) n/a
3 TRCN0000492228 GAGGCCCTGTACATACAGATGGTA pLX_317 67.8% 85.4% 85.3% V5 (many diffs) n/a
Download CSV